Incidental Mutation 'R4943:Nt5dc1'
ID383279
Institutional Source Beutler Lab
Gene Symbol Nt5dc1
Ensembl Gene ENSMUSG00000039480
Gene Name5'-nucleotidase domain containing 1
SynonymsNt5c2l1, 6030401B09Rik
MMRRC Submission 042540-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4943 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location34288288-34418552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34310391 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 58 (R58G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047885] [ENSMUST00000105512]
Predicted Effect probably benign
Transcript: ENSMUST00000047885
AA Change: R395G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047126
Gene: ENSMUSG00000039480
AA Change: R395G

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 382 2.6e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105512
AA Change: R394G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101151
Gene: ENSMUSG00000039480
AA Change: R394G

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 372 8.7e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129363
AA Change: R58G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130290
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] While the exact function of the protein encoded by this gene is not known, it belongs to the 5'(3')-deoxyribonucleotidase family. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,245,327 T366K possibly damaging Het
2510039O18Rik T A 4: 147,945,098 H508Q probably damaging Het
Actl9 G A 17: 33,433,085 V40M possibly damaging Het
Aen T A 7: 78,902,361 V23E probably damaging Het
Agbl1 G A 7: 76,420,016 R432K probably benign Het
Akap13 T A 7: 75,749,240 F2689I probably benign Het
Arhgap45 A G 10: 80,026,503 S475G probably benign Het
Atg7 A C 6: 114,697,084 Q231P probably benign Het
Calr3 A T 8: 72,431,377 V226D probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cops4 A T 5: 100,547,426 M404L probably benign Het
Cpne4 A T 9: 105,019,773 H375L probably damaging Het
D16Ertd472e A T 16: 78,575,989 V20D probably damaging Het
Dcun1d5 T C 9: 7,186,844 F55L possibly damaging Het
Dhx8 T A 11: 101,737,700 L93* probably null Het
Dtx4 A G 19: 12,501,060 L53P probably damaging Het
Ern2 C T 7: 122,173,258 R659H possibly damaging Het
Etl4 G A 2: 20,807,281 A1392T probably benign Het
Fat2 T C 11: 55,279,033 R2967G probably benign Het
Fat4 A G 3: 38,980,173 D2658G probably benign Het
Ftsj3 A G 11: 106,249,518 V808A probably damaging Het
Gm10447 A T 11: 53,456,389 Y104* probably null Het
Gm27013 A T 6: 130,676,200 C766* probably null Het
Gm438 T A 4: 144,777,720 E287V probably benign Het
Gm5581 A G 6: 131,167,125 noncoding transcript Het
Gpr158 G A 2: 21,827,157 V1023I probably damaging Het
Hectd2 T G 19: 36,604,247 probably null Het
Hmcn2 T C 2: 31,335,492 Y138H probably damaging Het
Kif28 T C 1: 179,713,951 I369V probably benign Het
Kif4-ps C T 12: 101,149,217 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map3k20 G A 2: 72,371,918 M164I possibly damaging Het
Map4k4 A G 1: 40,019,594 I1050V probably damaging Het
Med23 T A 10: 24,875,669 V133D possibly damaging Het
Mycn A T 12: 12,937,079 L439Q probably damaging Het
Myh2 G T 11: 67,197,317 A1920S probably damaging Het
Myom3 T C 4: 135,814,274 V1392A possibly damaging Het
Nktr T A 9: 121,719,954 probably benign Het
Nme3 A G 17: 24,896,723 K48E probably damaging Het
Nup205 A G 6: 35,224,639 E1270G probably damaging Het
Olfr106-ps G T 17: 37,395,025 A162S probably benign Het
Olfr1509 C G 14: 52,450,594 Y60* probably null Het
Olfr630 A T 7: 103,755,296 F96L probably benign Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pclo T C 5: 14,712,637 L3708P unknown Het
Pde4dip A T 3: 97,755,511 N590K probably damaging Het
Prokr1 A C 6: 87,581,824 I193S possibly damaging Het
Pxdc1 C A 13: 34,639,006 probably null Het
Rapgef2 A T 3: 79,064,547 S1494T probably benign Het
Rbms3 G C 9: 116,678,505 probably benign Het
Reep3 T A 10: 67,096,263 probably benign Het
Rwdd2b T C 16: 87,434,534 K244R possibly damaging Het
Srrm2 T C 17: 23,822,415 V2533A possibly damaging Het
Stab2 T C 10: 86,954,162 Y580C probably damaging Het
Stac2 G T 11: 98,041,572 S198R probably benign Het
Tdp2 T A 13: 24,838,265 N222K probably benign Het
Tex21 A G 12: 76,221,700 S103P probably damaging Het
Thbs1 A T 2: 118,113,449 I183F probably damaging Het
Tm9sf1 T C 14: 55,641,168 I256V probably damaging Het
Tmem207 C T 16: 26,517,853 W50* probably null Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Vmn1r227 A T 17: 20,735,361 noncoding transcript Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r75 A T 7: 86,165,497 S263T probably damaging Het
Wdr64 G A 1: 175,720,316 V140I probably benign Het
Xpo4 T C 14: 57,638,240 I145M possibly damaging Het
Zan G A 5: 137,457,890 T1336I unknown Het
Zdbf2 G T 1: 63,302,914 V151F possibly damaging Het
Zfhx3 T C 8: 108,948,317 S2000P probably damaging Het
Zfp65 T A 13: 67,710,980 I12F probably damaging Het
Zfp703 C A 8: 26,979,591 Q428K probably benign Het
Zfp947 A C 17: 22,145,832 M287R probably benign Het
Zfp976 A T 7: 42,612,422 probably benign Het
Other mutations in Nt5dc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Nt5dc1 APN 10 34407557 missense possibly damaging 0.80
IGL02096:Nt5dc1 APN 10 34399810 nonsense probably null
IGL02471:Nt5dc1 APN 10 34403725 missense probably benign 0.03
IGL03345:Nt5dc1 APN 10 34324462 missense probably benign 0.04
R0083:Nt5dc1 UTSW 10 34403764 missense probably damaging 0.98
R1159:Nt5dc1 UTSW 10 34398173 missense possibly damaging 0.93
R1898:Nt5dc1 UTSW 10 34313635 missense probably benign 0.00
R1901:Nt5dc1 UTSW 10 34313671 missense probably damaging 1.00
R2327:Nt5dc1 UTSW 10 34313677 missense possibly damaging 0.66
R4365:Nt5dc1 UTSW 10 34310381 missense probably benign 0.20
R4942:Nt5dc1 UTSW 10 34322677 missense probably damaging 1.00
R5168:Nt5dc1 UTSW 10 34397240 missense probably benign 0.05
R5507:Nt5dc1 UTSW 10 34397230 missense probably benign
R5605:Nt5dc1 UTSW 10 34403695 missense probably benign 0.12
R6406:Nt5dc1 UTSW 10 34324408 missense probably benign 0.04
R6495:Nt5dc1 UTSW 10 34324369 missense probably damaging 1.00
R6799:Nt5dc1 UTSW 10 34313707 missense possibly damaging 0.79
R6835:Nt5dc1 UTSW 10 34310379 missense probably benign 0.04
R7480:Nt5dc1 UTSW 10 34324453 missense probably damaging 1.00
R7480:Nt5dc1 UTSW 10 34324454 missense probably damaging 1.00
R7486:Nt5dc1 UTSW 10 34399809 missense probably benign 0.26
R7493:Nt5dc1 UTSW 10 34304936 missense probably benign 0.00
R7638:Nt5dc1 UTSW 10 34314796 missense probably benign 0.04
R8042:Nt5dc1 UTSW 10 34397214 missense probably benign 0.19
R8160:Nt5dc1 UTSW 10 34324396 missense possibly damaging 0.79
R8268:Nt5dc1 UTSW 10 34310411 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTTTTGAAGACAACAGCTC -3'
(R):5'- GGTCATGTTAAAGTGCACTCATAG -3'

Sequencing Primer
(F):5'- TGAAGACAACAGCTCTCTCTAATGG -3'
(R):5'- TGTTAAAGTGCACTCATAGTAAGGAG -3'
Posted On2016-04-27