Incidental Mutation 'R4969:Gas7'
ID384286
Institutional Source Beutler Lab
Gene Symbol Gas7
Ensembl Gene ENSMUSG00000033066
Gene Namegrowth arrest specific 7
SynonymsB230343A10Rik, Gas7-cb
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4969 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67455437-67688990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67683408 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 403 (E403G)
Ref Sequence ENSEMBL: ENSMUSP00000104322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021289] [ENSMUST00000041611] [ENSMUST00000108680] [ENSMUST00000108681] [ENSMUST00000108682]
Predicted Effect probably benign
Transcript: ENSMUST00000021289
SMART Domains Protein: ENSMUSP00000021289
Gene: ENSMUSG00000049928

DomainStartEndE-ValueType
Pfam:7tm_2 17 225 4.8e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000041611
AA Change: E399G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038420
Gene: ENSMUSG00000033066
AA Change: E399G

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108680
AA Change: E399G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104320
Gene: ENSMUSG00000033066
AA Change: E399G

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108681
AA Change: E399G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104321
Gene: ENSMUSG00000033066
AA Change: E399G

DomainStartEndE-ValueType
WW 14 46 1.39e-11 SMART
FCH 146 232 6.62e-25 SMART
coiled coil region 260 304 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108682
AA Change: E403G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104322
Gene: ENSMUSG00000033066
AA Change: E403G

DomainStartEndE-ValueType
WW 18 50 1.39e-11 SMART
FCH 150 236 6.62e-25 SMART
coiled coil region 264 308 N/A INTRINSIC
low complexity region 339 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140863
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Growth arrest-specific 7 is expressed primarily in terminally differentiated brain cells and predominantly in mature cerebellar Purkinje neurons. GAS7 plays a putative role in neuronal development. Several transcript variants encoding proteins which vary in the N-terminus have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aged mice homozygous for a hypomorphic allele show impaired coordination, decreased grip strength, decreased motor neuron number, muscle weakness, abnormal skeletal muscle fiber type ratio in the soleus muscle, and defects in motor neuron axon terminal sprouting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,105,519 I1525T probably benign Het
Agtpbp1 A G 13: 59,500,578 V476A probably benign Het
Aipl1 A G 11: 72,031,430 I151T probably benign Het
Apc C T 18: 34,312,918 R938* probably null Het
Atp2a2 A G 5: 122,458,491 F855S possibly damaging Het
Axdnd1 T C 1: 156,395,505 T261A possibly damaging Het
Cbfa2t2 A G 2: 154,523,980 D370G probably damaging Het
Cep350 T C 1: 155,860,279 I2964V probably damaging Het
Clec16a T C 16: 10,568,511 V158A probably damaging Het
Col6a5 G A 9: 105,864,607 T2371I probably damaging Het
Cpne8 T C 15: 90,619,726 T79A probably damaging Het
Cyp2b13 A G 7: 26,080,988 R145G probably damaging Het
Disc1 G A 8: 125,124,550 W391* probably null Het
Dnah8 G A 17: 30,723,014 V1745I probably damaging Het
Dsp T C 13: 38,192,910 V1557A probably benign Het
Egfem1 T A 3: 29,582,996 Y194N probably damaging Het
Eif4a3 A G 11: 119,288,879 Y361H probably damaging Het
Esd T A 14: 74,744,713 S189R possibly damaging Het
Fancf A T 7: 51,861,448 Y269* probably null Het
Fbln2 A T 6: 91,271,587 H1078L possibly damaging Het
Fbxw13 A G 9: 109,181,524 probably null Het
Fcgr2b A T 1: 170,963,372 V284D probably benign Het
Fuz G A 7: 44,900,294 G363R probably damaging Het
Gnl1 A G 17: 35,980,689 D49G possibly damaging Het
Gucy2g A G 19: 55,226,013 V561A probably benign Het
H1fnt A T 15: 98,256,335 V311E unknown Het
Hebp2 T C 10: 18,544,374 T104A probably benign Het
Ighv1-19 T A 12: 114,708,757 Q80L probably benign Het
Kctd19 T A 8: 105,396,327 probably null Het
Kdm3b T C 18: 34,822,375 L905P probably damaging Het
Klkb1 T C 8: 45,282,777 D183G probably benign Het
Krt6b T C 15: 101,680,025 R67G possibly damaging Het
Krt75 T C 15: 101,573,813 I7V probably benign Het
Lpo A T 11: 87,806,925 N685K probably benign Het
Mroh7 A T 4: 106,680,873 I1202N probably benign Het
Muc4 T A 16: 32,754,572 M1482K probably benign Het
Mylk T A 16: 34,971,440 V1494E probably damaging Het
Neurl4 A G 11: 69,911,087 D17G probably damaging Het
Nkx6-3 A G 8: 23,157,709 Y228C probably damaging Het
Nprl2 G A 9: 107,543,074 probably null Het
Nxf1 A G 19: 8,762,305 probably null Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr654 A T 7: 104,588,523 N240Y probably damaging Het
Pde3b A G 7: 114,519,612 E662G possibly damaging Het
Plekhm3 G A 1: 64,937,919 R131C probably damaging Het
Plpp7 T C 2: 32,095,938 S43P probably benign Het
Pramel5 A G 4: 144,271,617 L352P probably damaging Het
Prepl T C 17: 85,088,474 S27G probably benign Het
Ptprd A G 4: 76,133,305 I227T probably damaging Het
Pttg1ip C T 10: 77,584,020 Q6* probably null Het
Rgl1 C T 1: 152,549,062 probably null Het
Riiad1 C A 3: 94,472,866 G41* probably null Het
Rnf214 C T 9: 45,896,188 R239H probably damaging Het
Rpap3 C T 15: 97,686,526 V346I probably benign Het
Scaf4 G A 16: 90,251,943 Q328* probably null Het
Sec23a A G 12: 59,004,488 probably null Het
Slc5a8 T A 10: 88,904,912 probably null Het
Slc9a8 A G 2: 167,446,529 T183A probably benign Het
Sod3 A T 5: 52,368,394 H145L probably damaging Het
Sp4 A G 12: 118,299,606 V235A probably damaging Het
Spp1 A C 5: 104,440,287 E185A possibly damaging Het
Susd1 A T 4: 59,351,679 W461R probably benign Het
Svil A C 18: 5,095,516 K1124Q probably damaging Het
Tdrd12 A T 7: 35,487,295 probably null Het
Terb1 A T 8: 104,495,163 N168K probably benign Het
Tnnt1 A G 7: 4,507,574 L216P probably damaging Het
Ttc28 A G 5: 111,276,255 K1463E probably damaging Het
Twf2 T G 9: 106,211,899 probably null Het
Urb1 C T 16: 90,805,411 R90Q probably damaging Het
Wdr45b A T 11: 121,328,824 C299* probably null Het
Wrap73 A G 4: 154,152,681 S54G probably damaging Het
Zeb2 T C 2: 44,998,919 K323R probably damaging Het
Zfp410 T C 12: 84,331,808 I302T possibly damaging Het
Other mutations in Gas7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Gas7 APN 11 67652914 critical splice donor site probably null
IGL01634:Gas7 APN 11 67674231 splice site probably benign
IGL02215:Gas7 APN 11 67643332 missense probably benign 0.33
IGL02338:Gas7 APN 11 67682731 missense probably damaging 0.99
IGL02547:Gas7 APN 11 67665435 missense probably damaging 0.99
IGL02679:Gas7 APN 11 67675727 splice site probably null
IGL02959:Gas7 APN 11 67674235 splice site probably benign
BB007:Gas7 UTSW 11 67665391 missense probably damaging 1.00
BB017:Gas7 UTSW 11 67665391 missense probably damaging 1.00
R0029:Gas7 UTSW 11 67643337 missense probably benign 0.05
R0335:Gas7 UTSW 11 67662052 missense possibly damaging 0.84
R0931:Gas7 UTSW 11 67652925 splice site probably benign
R1165:Gas7 UTSW 11 67670686 splice site probably benign
R1459:Gas7 UTSW 11 67662076 missense probably damaging 1.00
R2425:Gas7 UTSW 11 67643295 missense probably benign 0.00
R4953:Gas7 UTSW 11 67660050 missense possibly damaging 0.69
R5327:Gas7 UTSW 11 67662090 missense probably damaging 1.00
R6145:Gas7 UTSW 11 67629612 missense probably damaging 1.00
R6631:Gas7 UTSW 11 67674281 missense probably damaging 1.00
R6885:Gas7 UTSW 11 67683387 missense probably damaging 0.99
R6914:Gas7 UTSW 11 67660151 splice site probably null
R6942:Gas7 UTSW 11 67660151 splice site probably null
R7930:Gas7 UTSW 11 67665391 missense probably damaging 1.00
R8070:Gas7 UTSW 11 67683434 missense probably damaging 1.00
R8358:Gas7 UTSW 11 67652908 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTTCTAGAAAGGGTGATCTGAGG -3'
(R):5'- ATGGCCTGGAAATACTGGGG -3'

Sequencing Primer
(F):5'- GTGGCTCTCCAACTGCAG -3'
(R):5'- CCTGGAAATACTGGGGAGTCC -3'
Posted On2016-04-27