Mutagenetix > Incidental Mutations

Incidental Mutation 'R4969:Axdnd1'

384241

Institutional Source

Beutler Lab

Gene Symbol

Axdnd1

Ensembl Gene

ENSMUSG00000026601

Gene Name

axonemal dynein light chain domain containing 1

Synonyms

LOC381304, 9430070O13Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R4969 (G1)

Quality Score

157

Status

Not validated

Chromosome

Chromosomal Location

156323509-156421159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 156395505 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 261 (T261A)

Ref Sequence

ENSEMBL: ENSMUSP00000137354 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000213088]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000027895

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177824
AA Change: T196A

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: T196A

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	131	314	2.4e-12	PFAM
low complexity region	405	414	N/A	INTRINSIC
low complexity region	452	464	N/A	INTRINSIC
low complexity region	666	677	N/A	INTRINSIC
coiled coil region	787	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177858

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178036
AA Change: T261A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: T261A

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	196	380	3.3e-14	PFAM
low complexity region	470	479	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
low complexity region	731	742	N/A	INTRINSIC
coiled coil region	889	939	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000180173
AA Change: T68A

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213088
AA Change: T261A

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	A	G	7: 46,105,519	I1525T	probably benign	Het
Agtpbp1	A	G	13: 59,500,578	V476A	probably benign	Het
Aipl1	A	G	11: 72,031,430	I151T	probably benign	Het
Apc	C	T	18: 34,312,918	R938*	probably null	Het
Atp2a2	A	G	5: 122,458,491	F855S	possibly damaging	Het
Cbfa2t2	A	G	2: 154,523,980	D370G	probably damaging	Het
Cep350	T	C	1: 155,860,279	I2964V	probably damaging	Het
Clec16a	T	C	16: 10,568,511	V158A	probably damaging	Het
Col6a5	G	A	9: 105,864,607	T2371I	probably damaging	Het
Cpne8	T	C	15: 90,619,726	T79A	probably damaging	Het
Cyp2b13	A	G	7: 26,080,988	R145G	probably damaging	Het
Disc1	G	A	8: 125,124,550	W391*	probably null	Het
Dnah8	G	A	17: 30,723,014	V1745I	probably damaging	Het
Dsp	T	C	13: 38,192,910	V1557A	probably benign	Het
Egfem1	T	A	3: 29,582,996	Y194N	probably damaging	Het
Eif4a3	A	G	11: 119,288,879	Y361H	probably damaging	Het
Esd	T	A	14: 74,744,713	S189R	possibly damaging	Het
Fancf	A	T	7: 51,861,448	Y269*	probably null	Het
Fbln2	A	T	6: 91,271,587	H1078L	possibly damaging	Het
Fbxw13	A	G	9: 109,181,524		probably null	Het
Fcgr2b	A	T	1: 170,963,372	V284D	probably benign	Het
Fuz	G	A	7: 44,900,294	G363R	probably damaging	Het
Gas7	A	G	11: 67,683,408	E403G	probably damaging	Het
Gnl1	A	G	17: 35,980,689	D49G	possibly damaging	Het
Gucy2g	A	G	19: 55,226,013	V561A	probably benign	Het
H1fnt	A	T	15: 98,256,335	V311E	unknown	Het
Hebp2	T	C	10: 18,544,374	T104A	probably benign	Het
Ighv1-19	T	A	12: 114,708,757	Q80L	probably benign	Het
Kctd19	T	A	8: 105,396,327		probably null	Het
Kdm3b	T	C	18: 34,822,375	L905P	probably damaging	Het
Klkb1	T	C	8: 45,282,777	D183G	probably benign	Het
Krt6b	T	C	15: 101,680,025	R67G	possibly damaging	Het
Krt75	T	C	15: 101,573,813	I7V	probably benign	Het
Lpo	A	T	11: 87,806,925	N685K	probably benign	Het
Mroh7	A	T	4: 106,680,873	I1202N	probably benign	Het
Muc4	T	A	16: 32,754,572	M1482K	probably benign	Het
Mylk	T	A	16: 34,971,440	V1494E	probably damaging	Het
Neurl4	A	G	11: 69,911,087	D17G	probably damaging	Het
Nkx6-3	A	G	8: 23,157,709	Y228C	probably damaging	Het
Nprl2	G	A	9: 107,543,074		probably null	Het
Nxf1	A	G	19: 8,762,305		probably null	Het
Olfr1238	A	G	2: 89,406,426	F218L	probably benign	Het
Olfr654	A	T	7: 104,588,523	N240Y	probably damaging	Het
Pde3b	A	G	7: 114,519,612	E662G	possibly damaging	Het
Plekhm3	G	A	1: 64,937,919	R131C	probably damaging	Het
Plpp7	T	C	2: 32,095,938	S43P	probably benign	Het
Pramel5	A	G	4: 144,271,617	L352P	probably damaging	Het
Prepl	T	C	17: 85,088,474	S27G	probably benign	Het
Ptprd	A	G	4: 76,133,305	I227T	probably damaging	Het
Pttg1ip	C	T	10: 77,584,020	Q6*	probably null	Het
Rgl1	C	T	1: 152,549,062		probably null	Het
Riiad1	C	A	3: 94,472,866	G41*	probably null	Het
Rnf214	C	T	9: 45,896,188	R239H	probably damaging	Het
Rpap3	C	T	15: 97,686,526	V346I	probably benign	Het
Scaf4	G	A	16: 90,251,943	Q328*	probably null	Het
Sec23a	A	G	12: 59,004,488		probably null	Het
Slc5a8	T	A	10: 88,904,912		probably null	Het
Slc9a8	A	G	2: 167,446,529	T183A	probably benign	Het
Sod3	A	T	5: 52,368,394	H145L	probably damaging	Het
Sp4	A	G	12: 118,299,606	V235A	probably damaging	Het
Spp1	A	C	5: 104,440,287	E185A	possibly damaging	Het
Susd1	A	T	4: 59,351,679	W461R	probably benign	Het
Svil	A	C	18: 5,095,516	K1124Q	probably damaging	Het
Tdrd12	A	T	7: 35,487,295		probably null	Het
Terb1	A	T	8: 104,495,163	N168K	probably benign	Het
Tnnt1	A	G	7: 4,507,574	L216P	probably damaging	Het
Ttc28	A	G	5: 111,276,255	K1463E	probably damaging	Het
Twf2	T	G	9: 106,211,899		probably null	Het
Urb1	C	T	16: 90,805,411	R90Q	probably damaging	Het
Wdr45b	A	T	11: 121,328,824	C299*	probably null	Het
Wrap73	A	G	4: 154,152,681	S54G	probably damaging	Het
Zeb2	T	C	2: 44,998,919	K323R	probably damaging	Het
Zfp410	T	C	12: 84,331,808	I302T	possibly damaging	Het

Other mutations in Axdnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03058:Axdnd1	APN	1	156376663	missense	probably benign	0.41
IGL03075:Axdnd1	APN	1	156395442	missense	probably damaging	1.00
IGL03165:Axdnd1	APN	1	156378389	missense	probably benign	0.00
R0164:Axdnd1	UTSW	1	156378386	missense	possibly damaging	0.93
R0164:Axdnd1	UTSW	1	156378386	missense	possibly damaging	0.93
R0739:Axdnd1	UTSW	1	156380886	missense	possibly damaging	0.73
R1087:Axdnd1	UTSW	1	156365689	missense	probably benign	0.08
R1350:Axdnd1	UTSW	1	156378380	critical splice donor site	probably null
R1488:Axdnd1	UTSW	1	156348960	missense	probably damaging	1.00
R1493:Axdnd1	UTSW	1	156346701	missense	probably benign	0.03
R1845:Axdnd1	UTSW	1	156376544	missense	possibly damaging	0.58
R1900:Axdnd1	UTSW	1	156380774	splice site	probably null
R2126:Axdnd1	UTSW	1	156333214	missense	probably benign	0.03
R2163:Axdnd1	UTSW	1	156392003	missense	probably damaging	1.00
R2169:Axdnd1	UTSW	1	156418309	missense	probably damaging	1.00
R2380:Axdnd1	UTSW	1	156365651	missense	probably benign	0.02
R2568:Axdnd1	UTSW	1	156392749	missense	possibly damaging	0.90
R3052:Axdnd1	UTSW	1	156341870	missense	probably damaging	0.96
R3053:Axdnd1	UTSW	1	156341870	missense	probably damaging	0.96
R3767:Axdnd1	UTSW	1	156380858	missense	probably damaging	1.00
R3927:Axdnd1	UTSW	1	156419270	missense	probably damaging	1.00
R3936:Axdnd1	UTSW	1	156331639	missense	probably benign	0.01
R4829:Axdnd1	UTSW	1	156376646	missense	possibly damaging	0.93
R4882:Axdnd1	UTSW	1	156395559	splice site	probably null
R5091:Axdnd1	UTSW	1	156420410	missense	possibly damaging	0.83
R5510:Axdnd1	UTSW	1	156335350	missense	probably benign	0.03
R5549:Axdnd1	UTSW	1	156398534	missense	probably damaging	1.00
R5587:Axdnd1	UTSW	1	156351412	missense	probably damaging	1.00
R5792:Axdnd1	UTSW	1	156341889	missense	probably damaging	0.99
R5840:Axdnd1	UTSW	1	156348958	missense	probably damaging	1.00
R6187:Axdnd1	UTSW	1	156365612	splice site	probably null
R6208:Axdnd1	UTSW	1	156392856	intron	probably benign
R6369:Axdnd1	UTSW	1	156392745	missense	probably damaging	1.00
R6493:Axdnd1	UTSW	1	156380813	missense	probably damaging	1.00
R7014:Axdnd1	UTSW	1	156330962	splice site	probably null
R7115:Axdnd1	UTSW	1	156380876	missense
R7203:Axdnd1	UTSW	1	156382389	missense	probably damaging	0.98
R7352:Axdnd1	UTSW	1	156382477	missense	possibly damaging	0.91
R7447:Axdnd1	UTSW	1	156418232	critical splice donor site	probably null
R7470:Axdnd1	UTSW	1	156376516	missense
R7686:Axdnd1	UTSW	1	156395464	nonsense	probably null
R7793:Axdnd1	UTSW	1	156338743	critical splice donor site	probably null
R7809:Axdnd1	UTSW	1	156392801	nonsense	probably null
R7882:Axdnd1	UTSW	1	156397453	missense
R8256:Axdnd1	UTSW	1	156330666	missense	unknown
R8348:Axdnd1	UTSW	1	156418284	missense	probably benign	0.02
X0009:Axdnd1	UTSW	1	156388079	missense	possibly damaging	0.61
X0067:Axdnd1	UTSW	1	156376535	missense	possibly damaging	0.67
Z1176:Axdnd1	UTSW	1	156349063	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAAGCACTATGGAAAATGTAACATT -3'
(R):5'- AGCATCCAAAACTAGCTAGGTTTTA -3'

Sequencing Primer
(F):5'- GGAACCTGGAACATTCCA -3'
(R):5'- AGCTAGGTTTTAAAAGTCATTTCTGG -3'

Posted On

2016-04-27