Incidental Mutation 'R4997:Osmr'
ID385379
Institutional Source Beutler Lab
Gene Symbol Osmr
Ensembl Gene ENSMUSG00000022146
Gene Nameoncostatin M receptor
SynonymsOSMRB
MMRRC Submission 042591-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4997 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6813577-6874969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6815639 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 882 (P882Q)
Ref Sequence ENSEMBL: ENSMUSP00000135204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022746] [ENSMUST00000176826]
Predicted Effect probably benign
Transcript: ENSMUST00000022746
AA Change: P883Q

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022746
Gene: ENSMUSG00000022146
AA Change: P883Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 607 7.02e1 SMART
FN3 619 720 3.17e-4 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176554
Predicted Effect probably benign
Transcript: ENSMUST00000176826
AA Change: P882Q

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135204
Gene: ENSMUSG00000022146
AA Change: P882Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 606 2.77e1 SMART
FN3 618 719 3.17e-4 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit anemia, decreased hematocrit, and reduced erythroid progenitor, erythrocyte, platelet, and megakaryocyte cells. Homozygotes also show increased susceptibility to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T G 7: 28,143,924 S746A possibly damaging Het
A630023A22Rik A T 14: 34,053,666 M1L probably benign Het
Abca7 C A 10: 80,007,320 Q1210K possibly damaging Het
Abcc4 C T 14: 118,516,503 W1024* probably null Het
Accs A T 2: 93,841,883 Y213* probably null Het
Adam6a G T 12: 113,545,371 G455C probably damaging Het
Adcy1 A C 11: 7,161,298 Y863S probably benign Het
Adgrg1 A G 8: 95,009,520 D434G probably damaging Het
Afap1l1 C T 18: 61,751,808 R202Q probably benign Het
Aldh3a1 T C 11: 61,212,311 V27A probably benign Het
Antxr2 A G 5: 97,977,694 F235L probably benign Het
Arhgap23 T A 11: 97,452,020 V376E probably damaging Het
Brca1 A C 11: 101,524,333 S992A probably damaging Het
Calcrl A T 2: 84,351,248 C185* probably null Het
Cep152 T C 2: 125,586,351 T787A probably benign Het
Coch T A 12: 51,603,181 probably null Het
Col5a1 T A 2: 28,032,782 Y287* probably null Het
Dis3l A G 9: 64,311,942 S569P possibly damaging Het
Dnaic1 A G 4: 41,597,919 I74V possibly damaging Het
Dpy19l4 A G 4: 11,287,493 V394A probably benign Het
Egfem1 A G 3: 29,153,590 H122R probably benign Het
Endou A G 15: 97,719,577 L164P probably damaging Het
Epgn A G 5: 91,032,239 E80G possibly damaging Het
Fitm1 T C 14: 55,576,907 S287P probably benign Het
Foxm1 A G 6: 128,365,768 N22D probably benign Het
Gm5136 A G 10: 108,699,788 I102T probably benign Het
Gsdmc A T 15: 63,776,780 M426K probably damaging Het
Hmcn2 T A 2: 31,401,708 V2418D probably damaging Het
Hs3st2 T A 7: 121,500,456 L175Q possibly damaging Het
Il1r2 T C 1: 40,121,046 probably null Het
Il27ra A T 8: 84,039,527 Y209* probably null Het
Inpp5a A T 7: 139,400,738 S31C probably benign Het
Invs A G 4: 48,396,332 D335G probably damaging Het
Isg15 C T 4: 156,199,697 E125K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama4 C A 10: 39,092,266 T1468K probably damaging Het
Lce1a2 A G 3: 92,669,088 S56P unknown Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lmf1 G A 17: 25,588,676 W164* probably null Het
Mad2l1bp G T 17: 46,152,878 C73* probably null Het
Mpzl1 A C 1: 165,601,781 V230G probably damaging Het
Myo3b A G 2: 70,258,083 T869A possibly damaging Het
Ncor2 T C 5: 125,034,010 H1316R probably damaging Het
Nlrp1b T A 11: 71,218,334 I114F probably damaging Het
Nsun7 A G 5: 66,295,839 I632M probably benign Het
Nubp1 T C 16: 10,421,321 I234T probably benign Het
Olfml1 A G 7: 107,571,206 D100G probably damaging Het
Olfr22-ps1 T A 11: 73,954,786 L32Q probably damaging Het
Olfr498 C A 7: 108,465,494 Q57K probably benign Het
Olfr839-ps1 A T 9: 19,175,331 L115Q probably damaging Het
Peg10 TCAGGATCC TCAGGATCCCCAGCAGGATCC 6: 4,756,457 probably benign Het
Per2 T A 1: 91,450,783 T15S probably benign Het
Piezo2 A G 18: 63,083,113 Y1184H probably damaging Het
Pik3c2b C T 1: 133,105,081 A1560V probably damaging Het
Pik3cd A C 4: 149,658,984 L256R probably damaging Het
Ppl C A 16: 5,089,371 R1020L probably damaging Het
Ppp1r10 A G 17: 35,924,084 N60S probably damaging Het
Prkcg T C 7: 3,322,581 probably null Het
Prkci T C 3: 31,031,226 probably null Het
Prrc2b A G 2: 32,222,311 Y1929C probably damaging Het
Prss12 T C 3: 123,447,208 V17A probably benign Het
Qtrt1 A G 9: 21,417,358 N206S probably benign Het
Rad54l2 A C 9: 106,722,909 S50A possibly damaging Het
Rhov C T 2: 119,270,468 R96H probably damaging Het
Rph3a A T 5: 120,963,843 V110E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 A T 13: 11,595,306 N646K probably benign Het
Scn8a A G 15: 100,957,054 T141A probably damaging Het
Serping1 T C 2: 84,770,285 R238G possibly damaging Het
Shank3 T A 15: 89,549,698 W1474R probably damaging Het
Slc16a12 T A 19: 34,674,958 M263L probably benign Het
Spata13 T C 14: 60,709,459 V652A probably damaging Het
Spata31 G A 13: 64,919,723 M66I probably benign Het
Spem2 T C 11: 69,817,732 I136V probably benign Het
Supt5 T C 7: 28,316,037 H925R probably benign Het
Syk A T 13: 52,612,448 K190* probably null Het
Thsd1 T A 8: 22,243,324 V129D probably damaging Het
Tiprl A G 1: 165,220,190 V174A possibly damaging Het
Tmed4 T A 11: 6,274,500 probably null Het
Tnfrsf19 T C 14: 60,971,209 T288A probably benign Het
Tnfrsf25 T C 4: 152,117,696 probably null Het
Tpd52 A G 3: 8,934,996 L121S probably damaging Het
Trim30a T A 7: 104,411,620 K316N probably benign Het
Ttc3 T G 16: 94,452,982 D1221E probably damaging Het
Ttn C T 2: 76,884,059 probably benign Het
Ttn T C 2: 76,946,271 I1514V probably benign Het
Ulk2 T C 11: 61,799,156 T671A probably benign Het
Wasf1 C T 10: 40,934,604 P281S probably damaging Het
Wnt10b C A 15: 98,774,203 R211L probably damaging Het
Xpnpep3 T A 15: 81,448,376 C371* probably null Het
Zfp41 C T 15: 75,618,768 probably benign Het
Zfp553 T A 7: 127,235,511 N79K probably benign Het
Zmynd8 G T 2: 165,792,816 D1096E probably benign Het
Other mutations in Osmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Osmr APN 15 6844445 nonsense probably null
IGL00335:Osmr APN 15 6837023 missense probably benign 0.00
IGL00497:Osmr APN 15 6847066 missense probably benign 0.26
IGL00510:Osmr APN 15 6823631 nonsense probably null
IGL00811:Osmr APN 15 6815666 missense probably benign 0.28
IGL00959:Osmr APN 15 6824605 missense probably benign 0.12
IGL01115:Osmr APN 15 6847201 splice site probably benign
IGL01307:Osmr APN 15 6844427 missense probably damaging 1.00
IGL01330:Osmr APN 15 6842028 missense probably damaging 1.00
IGL01633:Osmr APN 15 6824604 missense probably damaging 1.00
IGL01780:Osmr APN 15 6828663 missense probably benign 0.00
IGL02164:Osmr APN 15 6842048 missense probably damaging 0.99
IGL02207:Osmr APN 15 6847147 missense probably benign 0.07
IGL02338:Osmr APN 15 6837729 nonsense probably null
IGL02350:Osmr APN 15 6828663 missense probably benign 0.00
IGL02357:Osmr APN 15 6828663 missense probably benign 0.00
IGL02545:Osmr APN 15 6823579 missense probably damaging 0.98
IGL02619:Osmr APN 15 6841994 missense probably damaging 1.00
IGL02685:Osmr APN 15 6815573 missense probably benign 0.00
IGL02959:Osmr APN 15 6815897 missense possibly damaging 0.93
IGL03303:Osmr APN 15 6842808 missense probably benign 0.03
FR4548:Osmr UTSW 15 6837703 small insertion probably benign
FR4737:Osmr UTSW 15 6837706 nonsense probably null
R0149:Osmr UTSW 15 6841951 critical splice donor site probably null
R0361:Osmr UTSW 15 6841951 critical splice donor site probably null
R0492:Osmr UTSW 15 6824518 missense probably damaging 1.00
R0538:Osmr UTSW 15 6841938 splice site probably benign
R0585:Osmr UTSW 15 6837793 missense probably benign
R0980:Osmr UTSW 15 6852440 missense probably benign 0.00
R1221:Osmr UTSW 15 6823561 nonsense probably null
R1922:Osmr UTSW 15 6844367 missense possibly damaging 0.67
R2067:Osmr UTSW 15 6815415 missense probably benign 0.00
R2136:Osmr UTSW 15 6852462 missense probably damaging 1.00
R2156:Osmr UTSW 15 6844410 missense probably benign 0.04
R3683:Osmr UTSW 15 6837053 missense possibly damaging 0.95
R3735:Osmr UTSW 15 6822080 missense probably damaging 1.00
R3736:Osmr UTSW 15 6822080 missense probably damaging 1.00
R4011:Osmr UTSW 15 6824533 missense probably benign 0.01
R4175:Osmr UTSW 15 6852546 missense probably damaging 1.00
R4555:Osmr UTSW 15 6815720 missense possibly damaging 0.73
R4581:Osmr UTSW 15 6842894 missense probably benign 0.00
R4751:Osmr UTSW 15 6842852 missense probably damaging 1.00
R4758:Osmr UTSW 15 6852555 missense probably benign 0.23
R4986:Osmr UTSW 15 6816580 critical splice donor site probably null
R5077:Osmr UTSW 15 6844393 nonsense probably null
R5093:Osmr UTSW 15 6821079 missense probably damaging 0.96
R5120:Osmr UTSW 15 6827275 missense probably benign 0.16
R5331:Osmr UTSW 15 6842881 missense probably damaging 1.00
R5812:Osmr UTSW 15 6837059 missense probably damaging 0.99
R5819:Osmr UTSW 15 6815787 missense probably benign 0.00
R5876:Osmr UTSW 15 6821047 missense probably benign 0.07
R5986:Osmr UTSW 15 6844453 missense probably benign 0.36
R6018:Osmr UTSW 15 6815795 missense probably damaging 1.00
R6164:Osmr UTSW 15 6860352 missense probably benign 0.00
R6217:Osmr UTSW 15 6823566 missense probably damaging 1.00
R6312:Osmr UTSW 15 6823638 missense probably damaging 1.00
R6349:Osmr UTSW 15 6821063 missense probably benign 0.00
R6898:Osmr UTSW 15 6815883 missense probably damaging 0.97
R7139:Osmr UTSW 15 6821088 missense possibly damaging 0.79
R7412:Osmr UTSW 15 6823567 missense probably damaging 1.00
R7527:Osmr UTSW 15 6827122 missense probably damaging 1.00
R7630:Osmr UTSW 15 6816971 missense possibly damaging 0.53
R7730:Osmr UTSW 15 6824482 missense probably damaging 1.00
R8094:Osmr UTSW 15 6815621 missense possibly damaging 0.64
R8187:Osmr UTSW 15 6821004 missense probably damaging 1.00
R8260:Osmr UTSW 15 6815416 missense probably benign 0.41
RF040:Osmr UTSW 15 6837701 small insertion probably benign
RF055:Osmr UTSW 15 6837700 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCCCGGGAACTACCATTTGC -3'
(R):5'- ACACAGTGTGTAGGCTCTGG -3'

Sequencing Primer
(F):5'- GGGAACTACCATTTGCCTTTTATAC -3'
(R):5'- AGGCTCTGGGAAACTTCACATTG -3'
Posted On2016-05-10