Mutagenetix > Incidental Mutations

Incidental Mutation 'R4581:Osmr'

343698

Institutional Source

Beutler Lab

Gene Symbol

Osmr

Ensembl Gene

ENSMUSG00000022146

Gene Name

oncostatin M receptor

Synonyms

OSMRB

MMRRC Submission

041802-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R4581 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

6813577-6874969 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 6842894 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 240 (V240I)

Ref Sequence

ENSEMBL: ENSMUSP00000135204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022746] [ENSMUST00000176826]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000022746
AA Change: V240I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000022746
Gene: ENSMUSG00000022146
AA Change: V240I

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	26	35	N/A	INTRINSIC
Blast:FN3	234	317	9e-38	BLAST
FN3	330	412	6.25e-3	SMART
FN3	427	512	2.75e0	SMART
FN3	523	607	7.02e1	SMART
FN3	619	720	3.17e-4	SMART
transmembrane domain	736	758	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175862

Predicted Effect

probably benign
Transcript: ENSMUST00000176826
AA Change: V240I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000135204
Gene: ENSMUSG00000022146
AA Change: V240I

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	26	35	N/A	INTRINSIC
Blast:FN3	234	317	9e-38	BLAST
FN3	330	412	6.25e-3	SMART
FN3	427	512	2.75e0	SMART
FN3	523	606	2.77e1	SMART
FN3	618	719	3.17e-4	SMART
transmembrane domain	735	757	N/A	INTRINSIC
low complexity region	775	786	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177478

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit anemia, decreased hematocrit, and reduced erythroid progenitor, erythrocyte, platelet, and megakaryocyte cells. Homozygotes also show increased susceptibility to diet-induced obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,171,798	P20T	possibly damaging	Het
3425401B19Rik	G	T	14: 32,661,871	S712R	possibly damaging	Het
4933427I04Rik	A	G	4: 123,860,353	D20G	possibly damaging	Het
Abca7	A	G	10: 80,006,568	D1112G	probably benign	Het
Actc1	G	T	2: 114,049,608	H175N	possibly damaging	Het
Adgrd1	C	T	5: 129,202,531	A863V	possibly damaging	Het
Ankrd17	T	C	5: 90,283,120	D935G	possibly damaging	Het
Ankrd7	T	A	6: 18,868,021	N95K	probably damaging	Het
Arhgef4	G	A	1: 34,732,124	E1171K	possibly damaging	Het
Ascc3	T	C	10: 50,711,025	I991T	probably damaging	Het
Cacna1s	T	A	1: 136,070,970		probably null	Het
Camk1d	A	T	2: 5,354,704	V177E	probably benign	Het
Cdh18	T	A	15: 23,226,783	I110N	probably damaging	Het
Cenpe	A	G	3: 135,247,000	K1484E	probably benign	Het
Cep68	A	G	11: 20,239,333	S560P	probably benign	Het
Cog3	G	T	14: 75,732,951	T352K	probably benign	Het
Cox6a2	A	G	7: 128,205,980	S44P	possibly damaging	Het
Csmd2	T	C	4: 128,369,088	V689A	probably benign	Het
Ddx60	A	T	8: 62,023,261	M1548L	possibly damaging	Het
Dennd5b	G	T	6: 149,016,984		silent	Het
Dlgap2	T	C	8: 14,846,679	Y1052H	probably damaging	Het
Dnaaf5	T	A	5: 139,184,685	D502E	probably damaging	Het
Efhb	C	A	17: 53,426,275	A523S	probably damaging	Het
Epha8	C	T	4: 136,933,464	V648M	probably damaging	Het
Fanca	C	T	8: 123,274,338		probably null	Het
Fbxw7	G	A	3: 84,967,545	E205K	probably benign	Het
Fer1l6	C	T	15: 58,640,226	T1514I	probably damaging	Het
Gm12886	T	C	4: 121,416,683	E112G	probably damaging	Het
Gm7535	T	C	17: 17,911,083		probably benign	Het
Irf2bp2	T	A	8: 126,591,255	Q524L	probably damaging	Het
Itih4	A	G	14: 30,900,968	D864G	probably benign	Het
Kdm4c	T	G	4: 74,357,339		probably null	Het
Ltn1	A	T	16: 87,402,024		probably null	Het
Mafa	G	T	15: 75,747,736	P63T	unknown	Het
Mars2	T	A	1: 55,237,862	L208H	probably damaging	Het
Myom2	A	G	8: 15,106,459	I769V	probably benign	Het
Nyap1	A	G	5: 137,736,022	S250P	probably damaging	Het
Olfr1082	A	T	2: 86,594,228	M200K	probably benign	Het
Pcdhga3	A	G	18: 37,676,881	T796A	probably benign	Het
Pclo	T	C	5: 14,675,505	V1459A	unknown	Het
Phactr3	A	C	2: 178,283,172	H300P	probably damaging	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plcd4	T	A	1: 74,548,224	W48R	probably damaging	Het
Prdm16	A	G	4: 154,323,353	S1140P	probably damaging	Het
Rarg	A	C	15: 102,252,551	S18A	possibly damaging	Het
Rfx4	T	A	10: 84,844,300	S114T	possibly damaging	Het
Sec14l4	G	A	11: 4,043,375		probably null	Het
Six1	T	G	12: 73,045,934	T165P	probably benign	Het
Skint4	T	C	4: 112,087,042	L17P	probably damaging	Het
Slc25a23	T	A	17: 57,052,740	Y337F	probably damaging	Het
Slc9a3	A	G	13: 74,164,165	Y627C	probably damaging	Het
Smu1	A	C	4: 40,737,401		probably null	Het
Spryd3	A	G	15: 102,130,364	S141P	probably damaging	Het
Src	A	T	2: 157,463,038	N175I	probably damaging	Het
Srcap	GCTCCTCCTCCTCCTCCT	GCTCCTCCTCCTCCT	7: 127,558,310		probably benign	Het
Stc2	A	G	11: 31,365,326		probably null	Het
Taf6l	T	C	19: 8,778,208	D261G	probably damaging	Het
Tal1	T	G	4: 115,064,722	V167G	probably damaging	Het
Tfec	G	A	6: 16,834,125	T261I	probably damaging	Het
Tgfb1	G	T	7: 25,697,230	S273I	possibly damaging	Het
Tmem8b	T	A	4: 43,685,760	V636E	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trappc11	A	T	8: 47,493,345	M1084K	probably damaging	Het
Trem3	A	C	17: 48,249,611	T37P	possibly damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Urb1	T	C	16: 90,788,146	D529G	probably benign	Het
Vmn2r8	T	A	5: 108,801,704	T426S	probably benign	Het
Yipf4	T	C	17: 74,499,094	Y243H	probably benign	Het
Zfp574	T	A	7: 25,081,313	C587S	probably damaging	Het
Zfp93	C	A	7: 24,275,668	H359Q	probably damaging	Het
Znfx1	T	C	2: 167,050,316	E660G	probably damaging	Het

Other mutations in Osmr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Osmr	APN	15	6844445	nonsense	probably null
IGL00335:Osmr	APN	15	6837023	missense	probably benign	0.00
IGL00497:Osmr	APN	15	6847066	missense	probably benign	0.26
IGL00510:Osmr	APN	15	6823631	nonsense	probably null
IGL00811:Osmr	APN	15	6815666	missense	probably benign	0.28
IGL00959:Osmr	APN	15	6824605	missense	probably benign	0.12
IGL01115:Osmr	APN	15	6847201	splice site	probably benign
IGL01307:Osmr	APN	15	6844427	missense	probably damaging	1.00
IGL01330:Osmr	APN	15	6842028	missense	probably damaging	1.00
IGL01633:Osmr	APN	15	6824604	missense	probably damaging	1.00
IGL01780:Osmr	APN	15	6828663	missense	probably benign	0.00
IGL02164:Osmr	APN	15	6842048	missense	probably damaging	0.99
IGL02207:Osmr	APN	15	6847147	missense	probably benign	0.07
IGL02338:Osmr	APN	15	6837729	nonsense	probably null
IGL02350:Osmr	APN	15	6828663	missense	probably benign	0.00
IGL02357:Osmr	APN	15	6828663	missense	probably benign	0.00
IGL02545:Osmr	APN	15	6823579	missense	probably damaging	0.98
IGL02619:Osmr	APN	15	6841994	missense	probably damaging	1.00
IGL02685:Osmr	APN	15	6815573	missense	probably benign	0.00
IGL02959:Osmr	APN	15	6815897	missense	possibly damaging	0.93
IGL03303:Osmr	APN	15	6842808	missense	probably benign	0.03
FR4548:Osmr	UTSW	15	6837703	small insertion	probably benign
FR4737:Osmr	UTSW	15	6837706	nonsense	probably null
R0149:Osmr	UTSW	15	6841951	critical splice donor site	probably null
R0361:Osmr	UTSW	15	6841951	critical splice donor site	probably null
R0492:Osmr	UTSW	15	6824518	missense	probably damaging	1.00
R0538:Osmr	UTSW	15	6841938	splice site	probably benign
R0585:Osmr	UTSW	15	6837793	missense	probably benign
R0980:Osmr	UTSW	15	6852440	missense	probably benign	0.00
R1221:Osmr	UTSW	15	6823561	nonsense	probably null
R1922:Osmr	UTSW	15	6844367	missense	possibly damaging	0.67
R2067:Osmr	UTSW	15	6815415	missense	probably benign	0.00
R2136:Osmr	UTSW	15	6852462	missense	probably damaging	1.00
R2156:Osmr	UTSW	15	6844410	missense	probably benign	0.04
R3683:Osmr	UTSW	15	6837053	missense	possibly damaging	0.95
R3735:Osmr	UTSW	15	6822080	missense	probably damaging	1.00
R3736:Osmr	UTSW	15	6822080	missense	probably damaging	1.00
R4011:Osmr	UTSW	15	6824533	missense	probably benign	0.01
R4175:Osmr	UTSW	15	6852546	missense	probably damaging	1.00
R4555:Osmr	UTSW	15	6815720	missense	possibly damaging	0.73
R4751:Osmr	UTSW	15	6842852	missense	probably damaging	1.00
R4758:Osmr	UTSW	15	6852555	missense	probably benign	0.23
R4986:Osmr	UTSW	15	6816580	critical splice donor site	probably null
R4997:Osmr	UTSW	15	6815639	missense	probably benign	0.25
R5077:Osmr	UTSW	15	6844393	nonsense	probably null
R5093:Osmr	UTSW	15	6821079	missense	probably damaging	0.96
R5120:Osmr	UTSW	15	6827275	missense	probably benign	0.16
R5331:Osmr	UTSW	15	6842881	missense	probably damaging	1.00
R5812:Osmr	UTSW	15	6837059	missense	probably damaging	0.99
R5819:Osmr	UTSW	15	6815787	missense	probably benign	0.00
R5876:Osmr	UTSW	15	6821047	missense	probably benign	0.07
R5986:Osmr	UTSW	15	6844453	missense	probably benign	0.36
R6018:Osmr	UTSW	15	6815795	missense	probably damaging	1.00
R6164:Osmr	UTSW	15	6860352	missense	probably benign	0.00
R6217:Osmr	UTSW	15	6823566	missense	probably damaging	1.00
R6312:Osmr	UTSW	15	6823638	missense	probably damaging	1.00
R6349:Osmr	UTSW	15	6821063	missense	probably benign	0.00
R6898:Osmr	UTSW	15	6815883	missense	probably damaging	0.97
R7139:Osmr	UTSW	15	6821088	missense	possibly damaging	0.79
R7412:Osmr	UTSW	15	6823567	missense	probably damaging	1.00
R7527:Osmr	UTSW	15	6827122	missense	probably damaging	1.00
R7630:Osmr	UTSW	15	6816971	missense	possibly damaging	0.53
R7730:Osmr	UTSW	15	6824482	missense	probably damaging	1.00
R7990:Osmr	UTSW	15	6852467	missense	possibly damaging	0.87
R8094:Osmr	UTSW	15	6815621	missense	possibly damaging	0.64
R8187:Osmr	UTSW	15	6821004	missense	probably damaging	1.00
R8260:Osmr	UTSW	15	6815416	missense	probably benign	0.41
R8366:Osmr	UTSW	15	6820954	missense	possibly damaging	0.82
R9051:Osmr	UTSW	15	6852546	missense	probably damaging	1.00
R9137:Osmr	UTSW	15	6827228	missense	probably benign	0.13
R9182:Osmr	UTSW	15	6821088	missense	probably damaging	1.00
R9238:Osmr	UTSW	15	6816605	missense	possibly damaging	0.90
R9260:Osmr	UTSW	15	6852552	missense	probably benign
RF040:Osmr	UTSW	15	6837701	small insertion	probably benign
RF055:Osmr	UTSW	15	6837700	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- GACACATCCAAGAGTATGTGTGTC -3'
(R):5'- ACCTGAAGAGCCTTTCTGGG -3'

Sequencing Primer
(F):5'- GAGAGAATCACTTGTCACATGAC -3'
(R):5'- GGGCTATTGATCTGCTGACTTCC -3'

Posted On

2015-09-24