Incidental Mutation 'R4986:3632451O06Rik'
ID385887
Institutional Source Beutler Lab
Gene Symbol 3632451O06Rik
Ensembl Gene ENSMUSG00000036242
Gene NameRIKEN cDNA 3632451O06 gene
Synonyms
MMRRC Submission 042580-MU
Accession Numbers

NCBI RefSeq: NM_026142.4; MGI:1914669

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4986 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49675952-49783383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49751654 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 619 (D619E)
Ref Sequence ENSEMBL: ENSMUSP00000113609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036972] [ENSMUST00000118129]
Predicted Effect probably benign
Transcript: ENSMUST00000036972
AA Change: D619E

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000036220
Gene: ENSMUSG00000036242
AA Change: D619E

DomainStartEndE-ValueType
Pfam:DUF4696 48 609 3.8e-224 PFAM
transmembrane domain 714 736 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118129
AA Change: D619E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113609
Gene: ENSMUSG00000036242
AA Change: D619E

DomainStartEndE-ValueType
coiled coil region 603 644 N/A INTRINSIC
transmembrane domain 714 736 N/A INTRINSIC
low complexity region 741 754 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226894
Meta Mutation Damage Score 0.0875 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.2%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,627,591 C1005S probably benign Het
Ccdc34 T C 2: 110,017,869 M1T probably null Het
Ceacam5 T A 7: 17,757,833 N709K possibly damaging Het
Ces2f G A 8: 104,952,025 S298N probably benign Het
Defa30 T A 8: 21,135,416 Y65* probably null Het
Dock3 A C 9: 106,931,983 C1314G probably damaging Het
Emc2 A G 15: 43,511,784 M226V probably benign Het
Fat3 T C 9: 15,998,340 Y2122C probably damaging Het
Gad1 A G 2: 70,600,693 D560G probably benign Het
Gm9944 T C 4: 144,453,190 probably benign Het
Gpr137c A T 14: 45,246,286 probably null Het
Igf2bp2 C T 16: 22,070,306 probably null Het
Igsf10 T C 3: 59,328,606 T1385A probably benign Het
Itpr2 T A 6: 146,240,342 N1734I probably damaging Het
Kbtbd6 A G 14: 79,452,609 H248R probably damaging Het
Macf1 C T 4: 123,391,121 R5650Q probably damaging Het
Mdh1 A G 11: 21,558,545 F266L possibly damaging Het
Mecom G T 3: 29,980,699 P466Q probably damaging Het
Muc20 A G 16: 32,777,635 probably benign Het
Olfr1151 T A 2: 87,857,514 L113Q probably damaging Het
Olfr1265 A T 2: 90,037,428 N170Y probably damaging Het
Osmr A G 15: 6,816,580 probably null Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Sacs T A 14: 61,213,043 Y4179* probably null Het
Sept11 T C 5: 93,161,241 V203A probably damaging Het
Skint9 T A 4: 112,391,713 T173S probably benign Het
Slain1 A T 14: 103,688,105 R296S probably damaging Het
Slc36a3 T A 11: 55,146,766 *93C probably null Het
Sp110 G A 1: 85,591,760 P116S probably benign Het
Srl T C 16: 4,496,782 Y332C probably benign Het
Ubtf G A 11: 102,314,174 H95Y probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Wdfy3 C T 5: 101,943,119 D532N probably benign Het
Ybx1 C T 4: 119,282,430 V123I probably damaging Het
Zfp944 A T 17: 22,339,230 H345Q probably damaging Het
Zfp993 T A 4: 146,657,557 F113I probably benign Het
Other mutations in 3632451O06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:3632451O06Rik APN 14 49773003 missense probably damaging 1.00
IGL00981:3632451O06Rik APN 14 49772990 missense probably damaging 1.00
IGL01447:3632451O06Rik APN 14 49768466 missense probably damaging 0.99
IGL01645:3632451O06Rik APN 14 49773554 missense probably damaging 1.00
IGL02135:3632451O06Rik APN 14 49773929 missense probably damaging 0.99
IGL02154:3632451O06Rik APN 14 49772942 missense possibly damaging 0.58
IGL02163:3632451O06Rik APN 14 49774157 missense possibly damaging 0.61
IGL03234:3632451O06Rik APN 14 49768516 missense probably damaging 1.00
P0014:3632451O06Rik UTSW 14 49751659 missense probably damaging 1.00
R0165:3632451O06Rik UTSW 14 49773786 missense probably benign
R0240:3632451O06Rik UTSW 14 49768402 splice site probably benign
R0553:3632451O06Rik UTSW 14 49682686 missense probably damaging 0.99
R0616:3632451O06Rik UTSW 14 49773656 missense possibly damaging 0.74
R0635:3632451O06Rik UTSW 14 49773143 missense probably benign 0.00
R1423:3632451O06Rik UTSW 14 49751439 missense probably damaging 1.00
R1547:3632451O06Rik UTSW 14 49773496 missense probably benign 0.01
R1642:3632451O06Rik UTSW 14 49768410 splice site probably null
R1657:3632451O06Rik UTSW 14 49773560 missense probably damaging 0.99
R1717:3632451O06Rik UTSW 14 49751664 missense probably damaging 0.99
R1875:3632451O06Rik UTSW 14 49682358 missense probably damaging 1.00
R1900:3632451O06Rik UTSW 14 49770583 missense probably damaging 1.00
R1916:3632451O06Rik UTSW 14 49768475 missense probably damaging 1.00
R1945:3632451O06Rik UTSW 14 49768483 missense probably damaging 1.00
R2102:3632451O06Rik UTSW 14 49774002 missense probably damaging 0.98
R2147:3632451O06Rik UTSW 14 49751571 missense probably benign 0.31
R2149:3632451O06Rik UTSW 14 49751571 missense probably benign 0.31
R3921:3632451O06Rik UTSW 14 49774202 missense probably benign 0.13
R4063:3632451O06Rik UTSW 14 49773987 missense probably benign 0.02
R4373:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4374:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4377:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4589:3632451O06Rik UTSW 14 49773582 missense probably damaging 1.00
R4940:3632451O06Rik UTSW 14 49773482 missense probably benign 0.15
R5047:3632451O06Rik UTSW 14 49770438 missense probably damaging 1.00
R5104:3632451O06Rik UTSW 14 49773472 missense possibly damaging 0.77
R5682:3632451O06Rik UTSW 14 49751586 missense probably damaging 1.00
R6357:3632451O06Rik UTSW 14 49773312 missense probably benign 0.10
R6478:3632451O06Rik UTSW 14 49773332 missense possibly damaging 0.61
R6673:3632451O06Rik UTSW 14 49770592 missense probably benign 0.00
R7035:3632451O06Rik UTSW 14 49773050 missense possibly damaging 0.77
R7054:3632451O06Rik UTSW 14 49773698 missense probably damaging 1.00
R7458:3632451O06Rik UTSW 14 49682739 missense probably damaging 1.00
R7536:3632451O06Rik UTSW 14 49774246 splice site probably null
R7944:3632451O06Rik UTSW 14 49773213 missense probably benign 0.25
R7945:3632451O06Rik UTSW 14 49773213 missense probably benign 0.25
R8049:3632451O06Rik UTSW 14 49773536 missense probably damaging 0.97
R8066:3632451O06Rik UTSW 14 49768523 missense possibly damaging 0.83
R8519:3632451O06Rik UTSW 14 49773236 missense probably damaging 1.00
X0026:3632451O06Rik UTSW 14 49682736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGACCTTGATTCTGCTG -3'
(R):5'- CCGTGGACTACTCAATGTTGAC -3'

Sequencing Primer
(F):5'- ACTCGATGGTCTCTGGCAC -3'
(R):5'- GTGGACTACTCAATGTTGACTTTAAC -3'
Posted On2016-05-10