Incidental Mutation 'R1423:3632451O06Rik'
ID161185
Institutional Source Beutler Lab
Gene Symbol 3632451O06Rik
Ensembl Gene ENSMUSG00000036242
Gene NameRIKEN cDNA 3632451O06 gene
Synonyms
MMRRC Submission 039479-MU
Accession Numbers

NCBI RefSeq: NM_026142.4; MGI:1914669

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1423 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49675952-49783383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49751439 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 691 (E691G)
Ref Sequence ENSEMBL: ENSMUSP00000113609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036972] [ENSMUST00000118129]
Predicted Effect probably damaging
Transcript: ENSMUST00000036972
AA Change: E691G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036220
Gene: ENSMUSG00000036242
AA Change: E691G

DomainStartEndE-ValueType
Pfam:DUF4696 48 609 3.8e-224 PFAM
transmembrane domain 714 736 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118129
AA Change: E691G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113609
Gene: ENSMUSG00000036242
AA Change: E691G

DomainStartEndE-ValueType
coiled coil region 603 644 N/A INTRINSIC
transmembrane domain 714 736 N/A INTRINSIC
low complexity region 741 754 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226894
Meta Mutation Damage Score 0.7171 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in 3632451O06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:3632451O06Rik APN 14 49773003 missense probably damaging 1.00
IGL00981:3632451O06Rik APN 14 49772990 missense probably damaging 1.00
IGL01447:3632451O06Rik APN 14 49768466 missense probably damaging 0.99
IGL01645:3632451O06Rik APN 14 49773554 missense probably damaging 1.00
IGL02135:3632451O06Rik APN 14 49773929 missense probably damaging 0.99
IGL02154:3632451O06Rik APN 14 49772942 missense possibly damaging 0.58
IGL02163:3632451O06Rik APN 14 49774157 missense possibly damaging 0.61
IGL03234:3632451O06Rik APN 14 49768516 missense probably damaging 1.00
P0014:3632451O06Rik UTSW 14 49751659 missense probably damaging 1.00
R0165:3632451O06Rik UTSW 14 49773786 missense probably benign
R0240:3632451O06Rik UTSW 14 49768402 splice site probably benign
R0553:3632451O06Rik UTSW 14 49682686 missense probably damaging 0.99
R0616:3632451O06Rik UTSW 14 49773656 missense possibly damaging 0.74
R0635:3632451O06Rik UTSW 14 49773143 missense probably benign 0.00
R1547:3632451O06Rik UTSW 14 49773496 missense probably benign 0.01
R1642:3632451O06Rik UTSW 14 49768410 splice site probably null
R1657:3632451O06Rik UTSW 14 49773560 missense probably damaging 0.99
R1717:3632451O06Rik UTSW 14 49751664 missense probably damaging 0.99
R1875:3632451O06Rik UTSW 14 49682358 missense probably damaging 1.00
R1900:3632451O06Rik UTSW 14 49770583 missense probably damaging 1.00
R1916:3632451O06Rik UTSW 14 49768475 missense probably damaging 1.00
R1945:3632451O06Rik UTSW 14 49768483 missense probably damaging 1.00
R2102:3632451O06Rik UTSW 14 49774002 missense probably damaging 0.98
R2147:3632451O06Rik UTSW 14 49751571 missense probably benign 0.31
R2149:3632451O06Rik UTSW 14 49751571 missense probably benign 0.31
R3921:3632451O06Rik UTSW 14 49774202 missense probably benign 0.13
R4063:3632451O06Rik UTSW 14 49773987 missense probably benign 0.02
R4373:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4374:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4377:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4589:3632451O06Rik UTSW 14 49773582 missense probably damaging 1.00
R4940:3632451O06Rik UTSW 14 49773482 missense probably benign 0.15
R4986:3632451O06Rik UTSW 14 49751654 missense probably damaging 0.97
R5047:3632451O06Rik UTSW 14 49770438 missense probably damaging 1.00
R5104:3632451O06Rik UTSW 14 49773472 missense possibly damaging 0.77
R5682:3632451O06Rik UTSW 14 49751586 missense probably damaging 1.00
R6357:3632451O06Rik UTSW 14 49773312 missense probably benign 0.10
R6478:3632451O06Rik UTSW 14 49773332 missense possibly damaging 0.61
R6673:3632451O06Rik UTSW 14 49770592 missense probably benign 0.00
R7035:3632451O06Rik UTSW 14 49773050 missense possibly damaging 0.77
R7054:3632451O06Rik UTSW 14 49773698 missense probably damaging 1.00
R7458:3632451O06Rik UTSW 14 49682739 missense probably damaging 1.00
R7536:3632451O06Rik UTSW 14 49774246 splice site probably null
R7944:3632451O06Rik UTSW 14 49773213 missense probably benign 0.25
R7945:3632451O06Rik UTSW 14 49773213 missense probably benign 0.25
R8049:3632451O06Rik UTSW 14 49773536 missense probably damaging 0.97
R8066:3632451O06Rik UTSW 14 49768523 missense possibly damaging 0.83
X0026:3632451O06Rik UTSW 14 49682736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTTCCAAAGCATCAAGTGACTA -3'
(R):5'- TCCCATAAACCGTGGACTACTCAATGT -3'

Sequencing Primer
(F):5'- TGGAGTTGTCTACGTAAAGCCAC -3'
(R):5'- agaagatgatgaggatgaagagg -3'
Posted On2014-03-14