Incidental Mutation 'R5029:Ppfia2'
ID391568
Institutional Source Beutler Lab
Gene Symbol Ppfia2
Ensembl Gene ENSMUSG00000053825
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
SynonymsLiprin-alpha2, E130120L08Rik
MMRRC Submission 042620-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5029 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location106470339-106935952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106857443 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 603 (T603N)
Ref Sequence ENSEMBL: ENSMUSP00000151545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029404] [ENSMUST00000217854]
Predicted Effect probably benign
Transcript: ENSMUST00000029404
AA Change: T603N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000029404
Gene: ENSMUSG00000053825
AA Change: T603N

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
coiled coil region 32 80 N/A INTRINSIC
coiled coil region 102 150 N/A INTRINSIC
coiled coil region 189 234 N/A INTRINSIC
coiled coil region 267 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
coiled coil region 643 691 N/A INTRINSIC
low complexity region 702 725 N/A INTRINSIC
SAM 895 964 6.27e-10 SMART
low complexity region 965 977 N/A INTRINSIC
SAM 1017 1084 1.69e-6 SMART
SAM 1105 1177 6.62e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217854
AA Change: T603N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0805 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein has been shown to bind the calcium/calmodulin-dependent serine protein kinase (MAGUK family) protein (also known as CASK) and proposed to regulate higher-order brain functions in mammals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Ank T C 15: 27,590,353 V341A probably benign Het
Bnip3 T A 7: 138,898,119 probably benign Het
C1galt1 A G 6: 7,863,931 K4E possibly damaging Het
Cbs T A 17: 31,615,482 Q511L possibly damaging Het
Ccdc117 T C 11: 5,534,897 H109R possibly damaging Het
Cdh4 T A 2: 179,881,949 V440D possibly damaging Het
Cnot4 T C 6: 35,078,027 N109S probably damaging Het
Dact2 A T 17: 14,195,852 S695R probably benign Het
Defa21 A T 8: 21,026,365 E75V probably damaging Het
Dimt1 A G 13: 106,957,122 D274G probably null Het
Dstyk G T 1: 132,449,324 V223L probably benign Het
Dync1h1 T A 12: 110,618,010 S616T possibly damaging Het
Fer1l6 A T 15: 58,643,920 I1619F probably benign Het
Gm4744 T A 6: 40,949,407 Y83F probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hpx T G 7: 105,591,764 Y434S probably damaging Het
Ints4 A G 7: 97,509,774 D451G probably benign Het
Itgb4 A T 11: 115,988,591 probably benign Het
Jph1 T A 1: 17,091,391 N349I possibly damaging Het
Klrg1 A G 6: 122,282,735 L26P probably benign Het
M1ap A C 6: 83,003,832 D233A probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mycbp2 A G 14: 103,156,510 S2762P probably benign Het
Myh11 T A 16: 14,205,625 Q1556L probably damaging Het
N4bp2 A G 5: 65,814,780 D1428G probably damaging Het
Ndc80 A C 17: 71,508,765 C342G probably benign Het
Nxn A C 11: 76,274,530 Y199* probably null Het
Olfr1057 A G 2: 86,374,890 I174T probably damaging Het
Olfr371 C T 8: 85,231,206 A237V probably benign Het
Olfr776 T A 10: 129,261,838 N292K probably benign Het
Pacs1 A G 19: 5,142,271 F691L probably benign Het
Pcdhga12 T C 18: 37,766,811 V232A probably benign Het
Pik3cb A T 9: 99,054,060 M773K probably damaging Het
Plxnb1 T C 9: 109,114,655 Y1937H probably damaging Het
Psg22 A G 7: 18,719,737 Y119C probably damaging Het
Saraf G T 8: 34,161,258 R86L probably damaging Het
Sh3bgrl2 T C 9: 83,548,489 S11P possibly damaging Het
Slc39a4 C T 15: 76,614,083 D385N probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stpg3 T C 2: 25,214,564 N13S probably damaging Het
Taf1a T A 1: 183,395,935 D50E possibly damaging Het
Tlr1 T A 5: 64,925,681 N518Y probably damaging Het
Tnik G A 3: 28,665,844 probably null Het
Tomm70a T A 16: 57,122,151 L97Q probably benign Het
Vmn2r97 T A 17: 18,947,911 V809E probably damaging Het
Vps13d T C 4: 145,156,282 I914V probably benign Het
Zfyve26 A T 12: 79,286,323 H291Q probably damaging Het
Zmynd15 G T 11: 70,462,561 C334F probably damaging Het
Other mutations in Ppfia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Ppfia2 APN 10 106819492 missense probably benign 0.25
IGL01296:Ppfia2 APN 10 106858207 missense probably damaging 0.98
IGL01385:Ppfia2 APN 10 106913699 missense probably damaging 1.00
IGL01592:Ppfia2 APN 10 106836048 splice site probably benign
IGL01899:Ppfia2 APN 10 106915751 critical splice donor site probably null
IGL02063:Ppfia2 APN 10 106904845 missense probably null 0.83
IGL02143:Ppfia2 APN 10 106857499 missense probably damaging 1.00
IGL02170:Ppfia2 APN 10 106800785 missense probably benign
IGL02565:Ppfia2 APN 10 106863386 critical splice donor site probably null
IGL02573:Ppfia2 APN 10 106828928 missense probably damaging 1.00
IGL02819:Ppfia2 APN 10 106906394 missense probably damaging 1.00
IGL02974:Ppfia2 APN 10 106800776 missense probably benign 0.08
IGL03165:Ppfia2 APN 10 106767487 missense probably damaging 1.00
IGL03255:Ppfia2 APN 10 106896507 missense possibly damaging 0.76
PIT4458001:Ppfia2 UTSW 10 106927847 missense probably benign 0.24
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0323:Ppfia2 UTSW 10 106896420 missense possibly damaging 0.84
R0391:Ppfia2 UTSW 10 106830714 splice site probably benign
R0667:Ppfia2 UTSW 10 106913694 missense probably damaging 0.97
R0782:Ppfia2 UTSW 10 106927731 missense probably benign 0.32
R0905:Ppfia2 UTSW 10 106819511 missense probably benign 0.43
R1401:Ppfia2 UTSW 10 106830657 missense possibly damaging 0.94
R1672:Ppfia2 UTSW 10 106830568 missense possibly damaging 0.53
R1723:Ppfia2 UTSW 10 106915672 splice site probably null
R1780:Ppfia2 UTSW 10 106896507 missense possibly damaging 0.76
R1847:Ppfia2 UTSW 10 106927710 missense probably benign 0.16
R2015:Ppfia2 UTSW 10 106474677 missense probably benign 0.01
R2051:Ppfia2 UTSW 10 106837299 missense probably damaging 0.98
R2061:Ppfia2 UTSW 10 106837329 missense possibly damaging 0.94
R2115:Ppfia2 UTSW 10 106762111 missense probably damaging 1.00
R2310:Ppfia2 UTSW 10 106854980 missense probably damaging 0.99
R2394:Ppfia2 UTSW 10 106819490 missense probably damaging 0.99
R2656:Ppfia2 UTSW 10 106865407 splice site probably null
R3113:Ppfia2 UTSW 10 106906395 nonsense probably null
R3968:Ppfia2 UTSW 10 106906521 missense probably damaging 0.99
R3977:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3978:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3979:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R4567:Ppfia2 UTSW 10 106865406 splice site probably null
R4632:Ppfia2 UTSW 10 106836044 splice site probably null
R4718:Ppfia2 UTSW 10 106858285 missense probably damaging 1.00
R4758:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4770:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4810:Ppfia2 UTSW 10 106915690 missense probably benign 0.01
R4841:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4842:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4914:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4916:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4917:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R5014:Ppfia2 UTSW 10 106865363 nonsense probably null
R5127:Ppfia2 UTSW 10 106835760 missense probably damaging 0.99
R5357:Ppfia2 UTSW 10 106904847 critical splice donor site probably null
R5420:Ppfia2 UTSW 10 106835701 missense possibly damaging 0.88
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6135:Ppfia2 UTSW 10 106857569 missense probably damaging 1.00
R6237:Ppfia2 UTSW 10 106913594 missense probably damaging 1.00
R6433:Ppfia2 UTSW 10 106913698 missense possibly damaging 0.94
R6457:Ppfia2 UTSW 10 106893500 missense probably damaging 1.00
R6542:Ppfia2 UTSW 10 106835725 missense probably damaging 0.99
R6674:Ppfia2 UTSW 10 106927772 missense probably benign 0.23
R6746:Ppfia2 UTSW 10 106906458 nonsense probably null
R6992:Ppfia2 UTSW 10 106474854 missense possibly damaging 0.88
R7060:Ppfia2 UTSW 10 106762109 missense probably damaging 1.00
R7346:Ppfia2 UTSW 10 106857495 missense possibly damaging 0.79
R7453:Ppfia2 UTSW 10 106927830 missense possibly damaging 0.82
R7555:Ppfia2 UTSW 10 106927826 missense probably benign 0.00
R7622:Ppfia2 UTSW 10 106830659 missense possibly damaging 0.86
R7637:Ppfia2 UTSW 10 106865403 critical splice donor site probably null
X0021:Ppfia2 UTSW 10 106474677 missense probably benign 0.06
X0022:Ppfia2 UTSW 10 106893434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTGCACTTCATAGGATGTC -3'
(R):5'- CCAGGAGATGCTAAGCCTAATATTTTG -3'

Sequencing Primer
(F):5'- AGCTGTGAAGGCATGCA -3'
(R):5'- GCTGTTAACACAATCAGTATCGATAC -3'
Posted On2016-06-06