Mutagenetix > Incidental Mutations

Incidental Mutation 'R0442:Usp54'

39237

Institutional Source

Beutler Lab

Gene Symbol

Usp54

Ensembl Gene

ENSMUSG00000034235

Gene Name

ubiquitin specific peptidase 54

Synonyms

C030002J06Rik, 4930429G18Rik

MMRRC Submission

038643-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0442 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20548912-20641063 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20607209 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 7 (Y7C)

Ref Sequence

ENSEMBL: ENSMUSP00000036214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022356] [ENSMUST00000035340]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022356
AA Change: Y7C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022356
Gene: ENSMUSG00000034235
AA Change: Y7C

Domain	Start	End	E-Value	Type
Pfam:UCH	30	349	2.4e-23	PFAM
Pfam:UCH_1	31	324	2.1e-7	PFAM
low complexity region	403	412	N/A	INTRINSIC
low complexity region	439	445	N/A	INTRINSIC
low complexity region	498	513	N/A	INTRINSIC
low complexity region	601	616	N/A	INTRINSIC
coiled coil region	682	712	N/A	INTRINSIC
low complexity region	808	826	N/A	INTRINSIC
low complexity region	881	894	N/A	INTRINSIC
low complexity region	1002	1020	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000035340
AA Change: Y7C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036214
Gene: ENSMUSG00000034235
AA Change: Y7C

Domain	Start	End	E-Value	Type
Pfam:UCH	31	349	2.3e-21	PFAM
low complexity region	403	412	N/A	INTRINSIC
low complexity region	439	445	N/A	INTRINSIC
low complexity region	498	513	N/A	INTRINSIC
low complexity region	601	616	N/A	INTRINSIC
coiled coil region	682	712	N/A	INTRINSIC
low complexity region	808	826	N/A	INTRINSIC
low complexity region	881	894	N/A	INTRINSIC
low complexity region	1002	1020	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127342

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143267

Meta Mutation Damage Score

0.1373

Coding Region Coverage

1x: 98.8%
3x: 97.5%
10x: 93.4%
20x: 81.2%

Validation Efficiency

99% (70/71)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	T	A	1: 25,396,470	N816Y	probably damaging	Het
Arfgef3	T	C	10: 18,677,815		probably benign	Het
Cd200	T	A	16: 45,397,155	S58C	probably damaging	Het
Cep128	C	T	12: 91,266,771	E508K	probably damaging	Het
Dnah2	C	A	11: 69,448,542	L3046F	probably damaging	Het
Duox2	T	C	2: 122,289,332	N872D	probably benign	Het
Fam90a1a	C	T	8: 21,963,058	T143I	probably benign	Het
Fdft1	T	C	14: 63,163,349	T112A	probably benign	Het
Gimap9	G	T	6: 48,678,066	G196*	probably null	Het
Grhl1	G	A	12: 24,612,170	R536Q	probably damaging	Het
Gtpbp3	T	A	8: 71,491,491	V293E	probably damaging	Het
Hcn3	A	T	3: 89,151,540	F251Y	probably damaging	Het
Hectd4	T	A	5: 121,323,982	C971S	possibly damaging	Het
Helz2	T	A	2: 181,232,209	D2164V	probably damaging	Het
Hif1an	T	G	19: 44,566,012	L188R	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Iqgap3	C	T	3: 88,115,959	P519L	probably damaging	Het
Jakmip1	T	G	5: 37,135,553		probably null	Het
Klra1	T	C	6: 130,372,872	Y201C	probably damaging	Het
Minpp1	T	C	19: 32,493,948	F299L	possibly damaging	Het
Myb	A	G	10: 21,126,196	S749P	probably benign	Het
Myo3b	T	C	2: 70,238,961		probably null	Het
Naip1	T	A	13: 100,444,516	R74S	probably benign	Het
Nt5m	A	G	11: 59,874,619	T158A	possibly damaging	Het
Obscn	A	T	11: 59,002,174		probably benign	Het
Olfr1475	T	G	19: 13,480,048	D50A	probably damaging	Het
Olfr312	T	A	11: 58,831,431	Y92*	probably null	Het
Olfr800	T	C	10: 129,659,824	I6T	probably benign	Het
Otogl	T	A	10: 107,876,855	T543S	probably damaging	Het
Pds5b	T	C	5: 150,716,544		probably benign	Het
Plekhm1	A	G	11: 103,397,174	M49T	possibly damaging	Het
Rabl6	A	T	2: 25,587,522	S305R	probably damaging	Het
Rad54b	G	A	4: 11,609,480		probably benign	Het
Rad54b	C	A	4: 11,610,362	R660S	probably benign	Het
Rexo5	T	C	7: 119,843,285	L542P	probably damaging	Het
Rp1	C	T	1: 4,346,747	D1381N	probably benign	Het
Scnn1a	T	G	6: 125,339,137	M346R	probably damaging	Het
Sirpb1c	A	G	3: 15,802,546	I380T	probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Sstr3	A	T	15: 78,540,397	L50Q	probably damaging	Het
St3gal6	C	A	16: 58,473,453	A238S	probably damaging	Het
St3gal6	G	T	16: 58,473,455	A237E	probably damaging	Het
Sun5	T	C	2: 153,870,952	D16G	possibly damaging	Het
Svil	A	T	18: 5,046,870	T39S	probably damaging	Het
Taar1	A	G	10: 23,920,482	Y26C	possibly damaging	Het
Ugt1a1	AT	A	1: 88,212,371		probably null	Het
Use1	T	C	8: 71,367,058		probably benign	Het
Zbtb37	A	G	1: 161,032,348	F129S	possibly damaging	Het
Zfhx2	T	C	14: 55,066,900	H1209R	possibly damaging	Het
Zfp28	T	C	7: 6,394,999	L811P	probably damaging	Het
Zfp616	T	C	11: 74,084,495	I530T	possibly damaging	Het

Other mutations in Usp54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Usp54	APN	14	20573837	missense	probably damaging	1.00
IGL01090:Usp54	APN	14	20586157	unclassified	probably benign
IGL02030:Usp54	APN	14	20565946	missense	probably benign	0.44
IGL02333:Usp54	APN	14	20589395	missense	probably damaging	1.00
IGL02642:Usp54	APN	14	20565072	splice site	probably benign
IGL02970:Usp54	APN	14	20577472	missense	probably damaging	1.00
IGL03371:Usp54	APN	14	20589368	unclassified	probably benign
BB003:Usp54	UTSW	14	20576968	missense	probably damaging	1.00
BB013:Usp54	UTSW	14	20576968	missense	probably damaging	1.00
R0050:Usp54	UTSW	14	20573755	unclassified	probably benign
R0383:Usp54	UTSW	14	20561252	missense	probably benign	0.00
R0427:Usp54	UTSW	14	20570364	missense	probably benign
R0574:Usp54	UTSW	14	20556254	missense	probably benign	0.00
R0638:Usp54	UTSW	14	20589369	unclassified	probably benign
R0789:Usp54	UTSW	14	20562157	missense	probably benign	0.01
R1272:Usp54	UTSW	14	20561110	missense	probably damaging	0.99
R1463:Usp54	UTSW	14	20550190	missense	probably benign	0.15
R1565:Usp54	UTSW	14	20607159	missense	probably damaging	1.00
R1721:Usp54	UTSW	14	20583440	nonsense	probably null
R1922:Usp54	UTSW	14	20560904	missense	probably benign	0.00
R2068:Usp54	UTSW	14	20577205	missense	probably damaging	1.00
R2216:Usp54	UTSW	14	20561840	missense	probably benign
R2285:Usp54	UTSW	14	20561178	missense	possibly damaging	0.52
R2426:Usp54	UTSW	14	20564940	missense	probably benign	0.00
R3855:Usp54	UTSW	14	20588420	missense	probably damaging	1.00
R3856:Usp54	UTSW	14	20588420	missense	probably damaging	1.00
R3907:Usp54	UTSW	14	20586113	missense	probably damaging	1.00
R4367:Usp54	UTSW	14	20561134	missense	probably benign	0.02
R4384:Usp54	UTSW	14	20550085	splice site	probably null
R4555:Usp54	UTSW	14	20561022	missense	probably benign	0.06
R4617:Usp54	UTSW	14	20550338	missense	probably benign	0.04
R4659:Usp54	UTSW	14	20564992	missense	probably damaging	1.00
R4672:Usp54	UTSW	14	20581529	intron	probably benign
R4928:Usp54	UTSW	14	20562192	missense	probably damaging	1.00
R5381:Usp54	UTSW	14	20586076	missense	probably damaging	1.00
R5408:Usp54	UTSW	14	20550433	missense	probably damaging	1.00
R5630:Usp54	UTSW	14	20565057	missense	probably damaging	1.00
R5841:Usp54	UTSW	14	20550283	missense	probably benign	0.04
R5886:Usp54	UTSW	14	20561842	missense	probably benign	0.28
R5922:Usp54	UTSW	14	20552071	splice site	probably null
R5975:Usp54	UTSW	14	20583351	missense	possibly damaging	0.77
R6074:Usp54	UTSW	14	20552099	missense	probably benign	0.02
R6183:Usp54	UTSW	14	20552245	missense	probably damaging	0.99
R6234:Usp54	UTSW	14	20583450	missense	probably damaging	1.00
R6303:Usp54	UTSW	14	20560968	missense	possibly damaging	0.95
R6304:Usp54	UTSW	14	20560968	missense	possibly damaging	0.95
R6695:Usp54	UTSW	14	20560869	missense	possibly damaging	0.94
R6774:Usp54	UTSW	14	20577228	missense	probably damaging	1.00
R6941:Usp54	UTSW	14	20562109	missense	probably benign
R7133:Usp54	UTSW	14	20561242	missense	probably benign	0.00
R7196:Usp54	UTSW	14	20588370	missense	probably damaging	1.00
R7409:Usp54	UTSW	14	20552245	missense	probably damaging	0.99
R7424:Usp54	UTSW	14	20577040	missense	probably benign	0.15
R7859:Usp54	UTSW	14	20588136	missense	probably benign	0.24
R7926:Usp54	UTSW	14	20576968	missense	probably damaging	1.00
R7954:Usp54	UTSW	14	20561913	missense	probably benign	0.01
R8489:Usp54	UTSW	14	20561536	missense	probably benign	0.31
R8745:Usp54	UTSW	14	20562108	missense	probably benign	0.00
R8775:Usp54	UTSW	14	20588398	missense	probably benign	0.03
R8775-TAIL:Usp54	UTSW	14	20588398	missense	probably benign	0.03
RF004:Usp54	UTSW	14	20561300	missense	possibly damaging	0.90
X0024:Usp54	UTSW	14	20577251	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- CTTGGGAGCCATCAAGTATCACATCTG -3'
(R):5'- GTAGGGAGGCCGTTTTAGCAACATAG -3'

Sequencing Primer
(F):5'- TCAAGTATCACATCTGAAAATCTGC -3'
(R):5'- AAAGGCACAGTTCCTTGCCT -3'

Posted On

2013-05-23