Incidental Mutation 'R6941:Usp54'
ID540567
Institutional Source Beutler Lab
Gene Symbol Usp54
Ensembl Gene ENSMUSG00000034235
Gene Nameubiquitin specific peptidase 54
SynonymsC030002J06Rik, 4930429G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6941 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location20548912-20641063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 20562109 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 880 (I880L)
Ref Sequence ENSEMBL: ENSMUSP00000036214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022356] [ENSMUST00000035340]
Predicted Effect probably benign
Transcript: ENSMUST00000022356
AA Change: I880L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022356
Gene: ENSMUSG00000034235
AA Change: I880L

DomainStartEndE-ValueType
Pfam:UCH 30 349 2.4e-23 PFAM
Pfam:UCH_1 31 324 2.1e-7 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035340
AA Change: I880L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036214
Gene: ENSMUSG00000034235
AA Change: I880L

DomainStartEndE-ValueType
Pfam:UCH 31 349 2.3e-21 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,541,147 I1557F probably damaging Het
Acad10 A T 5: 121,649,357 D176E probably damaging Het
Acta2 A T 19: 34,252,522 V11E probably damaging Het
Ampd2 T C 3: 108,079,293 H225R probably damaging Het
Arfgef3 A G 10: 18,625,455 Y1016H possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU018091 A G 7: 3,159,427 probably null Het
Birc2 A G 9: 7,819,468 V481A probably benign Het
C130060K24Rik G A 6: 65,447,401 M126I probably damaging Het
Cabp1 A T 5: 115,172,901 D295E probably damaging Het
Cd180 A T 13: 102,706,191 T582S probably benign Het
Cnksr3 A G 10: 7,126,758 S145P probably damaging Het
Ddx27 A G 2: 167,015,377 D15G possibly damaging Het
Dsc1 T C 18: 20,097,189 Y353C probably benign Het
Dsg1c C T 18: 20,267,923 T161I probably damaging Het
Epm2a A G 10: 11,391,085 probably null Het
Fat2 T C 11: 55,262,088 H3766R probably benign Het
Fjx1 A G 2: 102,450,558 V344A probably benign Het
Frmd3 A G 4: 74,098,126 I93V probably benign Het
Gbe1 TAGTAAGAGT TAGT 16: 70,433,556 probably benign Het
Gdf15 A G 8: 70,630,144 L104P possibly damaging Het
Glra3 G A 8: 55,940,926 R24Q probably benign Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Ighv1-9 A T 12: 114,583,828 M31K probably benign Het
Ipmk G A 10: 71,348,090 G47S probably null Het
Itsn2 T C 12: 4,629,641 I150T probably benign Het
Kcnq5 T C 1: 21,405,844 Y545C probably damaging Het
Klk1b8 C A 7: 43,952,789 H48Q possibly damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrrc34 T C 3: 30,624,820 Y376C probably benign Het
Mast4 A T 13: 102,804,714 D278E probably damaging Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Ndst4 T G 3: 125,609,511 H422Q possibly damaging Het
Nek7 T C 1: 138,502,638 E206G probably damaging Het
Nufip2 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 77,686,296 probably benign Het
Olfr1451 T A 19: 12,999,497 N170K possibly damaging Het
Pglyrp2 T C 17: 32,416,074 Y438C probably damaging Het
Pigr G T 1: 130,847,327 W497L probably damaging Het
Pkd2l2 G T 18: 34,416,883 V194L probably benign Het
Ppp1r16b A T 2: 158,696,148 K5M probably damaging Het
Psat1 A T 19: 15,920,943 S35R probably damaging Het
Rab11fip1 G A 8: 27,156,275 Q258* probably null Het
Rad51d A G 11: 82,889,797 L53P probably damaging Het
Rell2 G A 18: 37,958,288 A169T probably benign Het
Rnf19b T C 4: 129,082,779 I545T probably benign Het
Slc12a1 G T 2: 125,214,079 E843D possibly damaging Het
Slc1a4 A G 11: 20,304,346 S507P probably damaging Het
Slc6a1 G A 6: 114,313,512 W316* probably null Het
Spesp1 A G 9: 62,272,870 L252P probably damaging Het
Sphkap G A 1: 83,408,090 probably benign Het
Srcap A G 7: 127,542,597 T1850A probably damaging Het
Supv3l1 T C 10: 62,430,586 T604A possibly damaging Het
Tacr1 A G 6: 82,403,865 T86A possibly damaging Het
Tenm3 T C 8: 48,674,416 R76G probably damaging Het
Tmprss6 C A 15: 78,446,777 A419S probably damaging Het
Wwp2 T A 8: 107,548,502 V377D probably damaging Het
Zfp735 A T 11: 73,690,333 E65D probably benign Het
Zfy2 T C Y: 2,121,491 E134G probably benign Het
Other mutations in Usp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Usp54 APN 14 20573837 missense probably damaging 1.00
IGL01090:Usp54 APN 14 20586157 unclassified probably benign
IGL02030:Usp54 APN 14 20565946 missense probably benign 0.44
IGL02333:Usp54 APN 14 20589395 missense probably damaging 1.00
IGL02642:Usp54 APN 14 20565072 splice site probably benign
IGL02970:Usp54 APN 14 20577472 missense probably damaging 1.00
IGL03371:Usp54 APN 14 20589368 unclassified probably benign
BB003:Usp54 UTSW 14 20576968 missense probably damaging 1.00
BB013:Usp54 UTSW 14 20576968 missense probably damaging 1.00
R0050:Usp54 UTSW 14 20573755 unclassified probably benign
R0383:Usp54 UTSW 14 20561252 missense probably benign 0.00
R0427:Usp54 UTSW 14 20570364 missense probably benign
R0442:Usp54 UTSW 14 20607209 missense probably damaging 1.00
R0574:Usp54 UTSW 14 20556254 missense probably benign 0.00
R0638:Usp54 UTSW 14 20589369 unclassified probably benign
R0789:Usp54 UTSW 14 20562157 missense probably benign 0.01
R1272:Usp54 UTSW 14 20561110 missense probably damaging 0.99
R1463:Usp54 UTSW 14 20550190 missense probably benign 0.15
R1565:Usp54 UTSW 14 20607159 missense probably damaging 1.00
R1721:Usp54 UTSW 14 20583440 nonsense probably null
R1922:Usp54 UTSW 14 20560904 missense probably benign 0.00
R2068:Usp54 UTSW 14 20577205 missense probably damaging 1.00
R2216:Usp54 UTSW 14 20561840 missense probably benign
R2285:Usp54 UTSW 14 20561178 missense possibly damaging 0.52
R2426:Usp54 UTSW 14 20564940 missense probably benign 0.00
R3855:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3856:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3907:Usp54 UTSW 14 20586113 missense probably damaging 1.00
R4367:Usp54 UTSW 14 20561134 missense probably benign 0.02
R4384:Usp54 UTSW 14 20550085 splice site probably null
R4555:Usp54 UTSW 14 20561022 missense probably benign 0.06
R4617:Usp54 UTSW 14 20550338 missense probably benign 0.04
R4659:Usp54 UTSW 14 20564992 missense probably damaging 1.00
R4672:Usp54 UTSW 14 20581529 intron probably benign
R4928:Usp54 UTSW 14 20562192 missense probably damaging 1.00
R5381:Usp54 UTSW 14 20586076 missense probably damaging 1.00
R5408:Usp54 UTSW 14 20550433 missense probably damaging 1.00
R5630:Usp54 UTSW 14 20565057 missense probably damaging 1.00
R5841:Usp54 UTSW 14 20550283 missense probably benign 0.04
R5886:Usp54 UTSW 14 20561842 missense probably benign 0.28
R5922:Usp54 UTSW 14 20552071 splice site probably null
R5975:Usp54 UTSW 14 20583351 missense possibly damaging 0.77
R6074:Usp54 UTSW 14 20552099 missense probably benign 0.02
R6183:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R6234:Usp54 UTSW 14 20583450 missense probably damaging 1.00
R6303:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6304:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6695:Usp54 UTSW 14 20560869 missense possibly damaging 0.94
R6774:Usp54 UTSW 14 20577228 missense probably damaging 1.00
R7133:Usp54 UTSW 14 20561242 missense probably benign 0.00
R7196:Usp54 UTSW 14 20588370 missense probably damaging 1.00
R7409:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R7424:Usp54 UTSW 14 20577040 missense probably benign 0.15
R7859:Usp54 UTSW 14 20588136 missense probably benign 0.24
R7926:Usp54 UTSW 14 20576968 missense probably damaging 1.00
R7954:Usp54 UTSW 14 20561913 missense probably benign 0.01
RF004:Usp54 UTSW 14 20561300 missense possibly damaging 0.90
X0024:Usp54 UTSW 14 20577251 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AACAGCTGTTGTCCTCCCTG -3'
(R):5'- GGGGAATTTATTGTTAGTCAAGGCAC -3'

Sequencing Primer
(F):5'- GCATCTAATGGCAGGCATTC -3'
(R):5'- CACGGTGTGGCTGATTCTCTC -3'
Posted On2018-11-06