Incidental Mutation 'R5109:Olfr181'
ID393770
Institutional Source Beutler Lab
Gene Symbol Olfr181
Ensembl Gene ENSMUSG00000090951
Gene Nameolfactory receptor 181
SynonymsMOR184-4, GA_x54KRFPKG5P-55145984-55145034
MMRRC Submission 042697-MU
Accession Numbers

Genbank: NM_146999

Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5109 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58924707-58928755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58926059 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 171 (S171P)
Ref Sequence ENSEMBL: ENSMUSP00000145877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075361] [ENSMUST00000205668] [ENSMUST00000205742] [ENSMUST00000205986] [ENSMUST00000206168]
Predicted Effect probably benign
Transcript: ENSMUST00000075361
AA Change: S171P

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074825
Gene: ENSMUSG00000090951
AA Change: S171P

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 308 6.1e-6 PFAM
Pfam:7tm_1 41 308 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205668
Predicted Effect probably benign
Transcript: ENSMUST00000205742
AA Change: S171P

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000205986
AA Change: S171P

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000206168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214942
Meta Mutation Damage Score 0.3907 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1) 

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd17 T C 5: 90,243,536 S1841G possibly damaging Het
Anxa10 T C 8: 62,063,059 E193G possibly damaging Het
Ap3d1 T C 10: 80,709,450 S1056G probably benign Het
Apbb1 T C 7: 105,565,035 N62D probably damaging Het
Apobec2 A T 17: 48,422,994 Y215N probably damaging Het
Apobec2 T A 17: 48,422,996 Y214F probably damaging Het
Appl2 A T 10: 83,601,007 V630E probably benign Het
Bud23 T C 5: 135,061,023 probably benign Het
Cacna1b A T 2: 24,690,785 M683K possibly damaging Het
Cbfa2t2 T A 2: 154,531,373 D187E probably damaging Het
Cfap54 G T 10: 92,937,891 F96L probably benign Het
Crebbp A G 16: 4,088,431 probably benign Het
Crocc C T 4: 141,028,411 R1102Q probably damaging Het
Dcaf12 T C 4: 41,298,329 D273G possibly damaging Het
Dchs1 T C 7: 105,765,014 T865A probably benign Het
Dhfr A T 13: 92,355,280 I8F probably damaging Het
Dnaja2 A T 8: 85,553,258 F97L possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Doc2b T C 11: 75,777,141 D261G probably benign Het
Ear1 A G 14: 43,819,028 Y128H probably benign Het
Elac2 T A 11: 64,992,316 I171N probably damaging Het
Entpd3 C A 9: 120,566,314 N454K possibly damaging Het
Flrt3 A G 2: 140,660,743 S322P possibly damaging Het
Fn1 C T 1: 71,649,235 C170Y probably damaging Het
Gabbr1 T A 17: 37,072,028 probably benign Het
Gm597 T C 1: 28,777,555 I465M possibly damaging Het
Gm7247 T G 14: 51,365,317 S37A probably damaging Het
Gm8775 T A 3: 4,211,948 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gria4 A C 9: 4,472,168 N440K probably damaging Het
H2-T22 T A 17: 36,039,221 R334* probably null Het
Ift172 T C 5: 31,265,986 D817G probably benign Het
Igkv9-124 T A 6: 67,942,364 R21S possibly damaging Het
Itgam G A 7: 128,113,218 V846I probably benign Het
Kif11 T A 19: 37,384,615 M94K possibly damaging Het
Krtcap2 T C 3: 89,246,778 V2A probably benign Het
Lrrc47 A G 4: 154,017,476 D400G probably damaging Het
Man2a1 T A 17: 64,752,448 V1110E probably benign Het
Mfsd9 T A 1: 40,774,205 I317F probably damaging Het
Mindy4 A T 6: 55,216,745 probably null Het
Mrpl53 A G 6: 83,109,560 T82A probably damaging Het
Myo3b A G 2: 70,095,293 K35E possibly damaging Het
Nalcn A G 14: 123,278,238 V1717A possibly damaging Het
Ncoa2 A G 1: 13,186,846 V143A probably damaging Het
Ndufa9 A C 6: 126,832,557 probably null Het
Odf3 A T 7: 140,849,548 S197C probably benign Het
Olfr1014 G A 2: 85,777,324 V247M probably damaging Het
Olfr1121 A G 2: 87,371,534 M1V probably null Het
Olfr1130 G A 2: 87,607,411 A8T possibly damaging Het
Olfr1130 G A 2: 87,607,975 G196R possibly damaging Het
Olfr476 T C 7: 107,967,897 S167P probably benign Het
Olfr771 T C 10: 129,160,237 Y249C probably damaging Het
Olfr846 A T 9: 19,361,142 I71N probably damaging Het
Pde4b G T 4: 102,601,544 A466S probably damaging Het
Pfkfb3 A T 2: 11,486,351 probably benign Het
Ppp1r21 A G 17: 88,558,840 K355E probably damaging Het
Psme4 T A 11: 30,791,095 Y90* probably null Het
Rbms1 G A 2: 60,781,940 L161F probably damaging Het
Rdh16f2 A G 10: 127,866,803 D83G probably damaging Het
Sec16b C T 1: 157,564,791 R910* probably null Het
Sema4c CTGGGCTT C 1: 36,552,300 probably null Het
Stambp A G 6: 83,563,821 probably null Het
Tcf21 T C 10: 22,819,659 N82S probably damaging Het
Tlr2 A T 3: 83,837,723 V351D probably damaging Het
Tmem39a G A 16: 38,590,964 G359D probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Vmn2r17 C A 5: 109,429,476 F464L probably benign Het
Vmn2r49 T A 7: 9,976,277 T843S probably benign Het
Vmn2r7 T C 3: 64,690,667 D823G probably null Het
Wrnip1 T A 13: 32,816,336 L442Q probably damaging Het
Zbtb38 G T 9: 96,687,009 S674Y probably damaging Het
Zfp639 T G 3: 32,520,436 probably null Het
Other mutations in Olfr181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Olfr181 APN 16 58926566 missense probably benign
IGL02477:Olfr181 APN 16 58925763 missense probably benign 0.07
IGL02545:Olfr181 APN 16 58926470 missense possibly damaging 0.88
IGL02690:Olfr181 APN 16 58925851 missense possibly damaging 0.78
IGL02718:Olfr181 APN 16 58926096 missense possibly damaging 0.57
IGL02945:Olfr181 APN 16 58926340 missense probably damaging 1.00
IGL03349:Olfr181 APN 16 58925960 missense probably benign 0.00
B5639:Olfr181 UTSW 16 58926526 missense probably benign 0.00
R0550:Olfr181 UTSW 16 58926385 missense probably damaging 1.00
R0659:Olfr181 UTSW 16 58926409 missense possibly damaging 0.94
R1433:Olfr181 UTSW 16 58925686 missense probably benign
R1957:Olfr181 UTSW 16 58926167 missense probably benign
R2155:Olfr181 UTSW 16 58926123 missense probably benign 0.01
R2404:Olfr181 UTSW 16 58925635 missense probably benign 0.01
R2568:Olfr181 UTSW 16 58925923 missense probably benign 0.27
R4022:Olfr181 UTSW 16 58926120 missense possibly damaging 0.94
R4592:Olfr181 UTSW 16 58926092 missense probably benign 0.00
R4673:Olfr181 UTSW 16 58925690 missense possibly damaging 0.61
R4880:Olfr181 UTSW 16 58926100 missense probably damaging 0.98
R5231:Olfr181 UTSW 16 58925714 missense possibly damaging 0.94
R5291:Olfr181 UTSW 16 58926401 missense possibly damaging 0.96
R5477:Olfr181 UTSW 16 58926030 missense possibly damaging 0.61
R5524:Olfr181 UTSW 16 58925809 missense probably benign 0.00
R5809:Olfr181 UTSW 16 58926497 missense probably benign
R5830:Olfr181 UTSW 16 58926094 missense possibly damaging 0.64
R6119:Olfr181 UTSW 16 58926532 missense possibly damaging 0.94
R6217:Olfr181 UTSW 16 58926514 missense probably benign 0.03
R6861:Olfr181 UTSW 16 58926504 missense probably benign
R6939:Olfr181 UTSW 16 58926285 nonsense probably null
R7376:Olfr181 UTSW 16 58925758 missense possibly damaging 0.82
R7650:Olfr181 UTSW 16 58926053 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGGTCCAATATACATGAGAAGAC -3'
(R):5'- TTTCTTCTGGCAGCAATGGC -3'

Sequencing Primer
(F):5'- CCATCCTTGGATTTCATCTTGAAAAC -3'
(R):5'- AATGGCCTATGACCGCTATG -3'
Posted On2016-06-15