Incidental Mutation 'R5144:Olfr920'
ID395052
Institutional Source Beutler Lab
Gene Symbol Olfr920
Ensembl Gene ENSMUSG00000061039
Gene Nameolfactory receptor 920
SynonymsMOR165-6, GA_x6K02T2PVTD-32458442-32459374
MMRRC Submission 042728-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5144 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38752299-38760117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38756393 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 235 (S235L)
Ref Sequence ENSEMBL: ENSMUSP00000074300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074740
AA Change: S235L

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074300
Gene: ENSMUSG00000061039
AA Change: S235L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.2e-47 PFAM
Pfam:7tm_1 41 290 3.6e-22 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik C A 15: 98,585,267 probably null Het
4933409G03Rik T A 2: 68,616,260 probably benign Het
Arpc2 A T 1: 74,248,208 K62N probably damaging Het
B4galt5 C T 2: 167,306,596 E201K possibly damaging Het
Bub1b C T 2: 118,615,499 T334M possibly damaging Het
Ccdc71 T C 9: 108,463,852 V288A probably benign Het
Cep350 G A 1: 155,911,150 R1444W probably damaging Het
Chrna4 A G 2: 181,024,830 L605P probably damaging Het
Col6a5 T A 9: 105,889,283 I1813F probably damaging Het
Col9a1 A G 1: 24,239,353 I821V probably benign Het
D430041D05Rik T C 2: 104,258,502 D43G probably damaging Het
Depdc7 T C 2: 104,730,253 Y132C probably damaging Het
Dppa2 T C 16: 48,317,303 V216A probably damaging Het
Ect2l A T 10: 18,144,577 N598K probably benign Het
Eif3c T C 7: 126,563,066 T195A probably benign Het
Epg5 T C 18: 78,015,680 V1883A probably damaging Het
Ino80c T A 18: 24,108,878 D150V probably benign Het
Kcnb1 T A 2: 167,105,944 Y328F probably damaging Het
Kcnj3 G A 2: 55,447,047 probably null Het
Ncor1 T G 11: 62,349,464 S894R probably damaging Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Nod2 T C 8: 88,653,066 V72A probably damaging Het
Nudt19 T C 7: 35,555,225 T194A probably benign Het
Olfr350 A T 2: 36,850,144 T33S probably benign Het
Pappa2 T A 1: 158,957,133 R102S probably benign Het
Pik3c2a T C 7: 116,350,786 N1332S probably benign Het
Plppr1 T A 4: 49,319,800 V142E possibly damaging Het
Prdm6 C A 18: 53,465,038 probably benign Het
Prm2 T A 16: 10,791,868 probably benign Het
Prmt3 T C 7: 49,786,135 S155P possibly damaging Het
Rars2 T C 4: 34,656,793 Y481H probably benign Het
Rgs2 G A 1: 144,001,699 T206M probably benign Het
Slc2a8 C T 2: 32,981,773 R56H probably damaging Het
Stk35 T A 2: 129,810,935 M452K probably damaging Het
Tcf3 G A 10: 80,415,237 H454Y probably damaging Het
Tgm3 C T 2: 130,048,282 S655F possibly damaging Het
Tssc4 T G 7: 143,070,033 L26R probably damaging Het
Utp11 A T 4: 124,678,902 probably benign Het
Vmn1r237 C G 17: 21,314,426 A137G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T C 16: 21,559,353 L1038P probably damaging Het
Wipf3 C T 6: 54,485,675 A290V probably damaging Het
Zdhhc25 T G 15: 88,601,056 L198R probably damaging Het
Zdhhc6 A T 19: 55,314,566 M1K probably null Het
Other mutations in Olfr920
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Olfr920 APN 9 38756254 missense probably damaging 1.00
IGL01728:Olfr920 APN 9 38756095 missense possibly damaging 0.63
IGL01867:Olfr920 APN 9 38755898 missense probably damaging 1.00
IGL02271:Olfr920 APN 9 38756488 missense probably benign
IGL03078:Olfr920 APN 9 38756245 nonsense probably null
R0166:Olfr920 UTSW 9 38756188 missense probably benign
R0446:Olfr920 UTSW 9 38755818 missense probably damaging 1.00
R0453:Olfr920 UTSW 9 38756129 missense probably damaging 0.99
R0556:Olfr920 UTSW 9 38755745 missense possibly damaging 0.88
R1585:Olfr920 UTSW 9 38756420 missense probably damaging 1.00
R2847:Olfr920 UTSW 9 38756036 missense possibly damaging 0.89
R4676:Olfr920 UTSW 9 38755659 start gained probably benign
R4825:Olfr920 UTSW 9 38756407 missense probably damaging 1.00
R5026:Olfr920 UTSW 9 38755745 missense probably benign 0.01
R5573:Olfr920 UTSW 9 38755704 missense probably damaging 1.00
R5872:Olfr920 UTSW 9 38756116 missense probably benign 0.06
R6131:Olfr920 UTSW 9 38756066 missense probably damaging 1.00
R6729:Olfr920 UTSW 9 38755828 missense probably benign 0.00
R7731:Olfr920 UTSW 9 38756246 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTCGTTCTGTGATGGCAAC -3'
(R):5'- ACTTTAGGACCAGGAAAGTGTTTTC -3'

Sequencing Primer
(F):5'- GGCAACATCATCAACCACTATTTCTG -3'
(R):5'- CTCAAAGTTTTTCTCAAGGCAAC -3'
Posted On2016-06-21