Incidental Mutation 'R5039:Trpv5'
ID395695
Institutional Source Beutler Lab
Gene Symbol Trpv5
Ensembl Gene ENSMUSG00000036899
Gene Nametransient receptor potential cation channel, subfamily V, member 5
SynonymsECaC1, CaT2
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R5039 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41652173-41680769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41675945 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 98 (Y98C)
Ref Sequence ENSEMBL: ENSMUSP00000141421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031901] [ENSMUST00000193503]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031901
AA Change: Y98C

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031901
Gene: ENSMUSG00000036899
AA Change: Y98C

DomainStartEndE-ValueType
Blast:ANK 38 68 1e-7 BLAST
ANK 72 102 2.3e0 SMART
ANK 110 139 4.56e-4 SMART
ANK 156 185 1.85e-4 SMART
Blast:ANK 189 217 3e-10 BLAST
ANK 232 261 3.07e2 SMART
Pfam:Ion_trans 321 583 1.8e-19 PFAM
low complexity region 676 691 N/A INTRINSIC
low complexity region 708 719 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193503
AA Change: Y98C

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141421
Gene: ENSMUSG00000036899
AA Change: Y98C

DomainStartEndE-ValueType
Blast:ANK 38 68 1e-7 BLAST
ANK 72 102 1.5e-2 SMART
ANK 110 139 2.8e-6 SMART
ANK 156 185 1.2e-6 SMART
Blast:ANK 189 217 4e-10 BLAST
transmembrane domain 274 296 N/A INTRINSIC
Pfam:Ion_trans 335 522 2.7e-12 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transient receptor family and the TrpV subfamily. The calcium-selective channel encoded by this gene has 6 transmembrane-spanning domains, multiple potential phosphorylation sites, an N-linked glycosylation site, and 5 ANK repeats. This protein forms homotetramers or heterotetramers and is activated by a low internal calcium level. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit increased calcium excretion and reduced bone thickenss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Trpv5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Trpv5 APN 6 41675375 missense possibly damaging 0.87
IGL01704:Trpv5 APN 6 41653258 missense possibly damaging 0.88
IGL01860:Trpv5 APN 6 41660295 missense probably damaging 1.00
IGL01950:Trpv5 APN 6 41675978 missense probably benign 0.09
Firesign UTSW 6 41658042 missense probably damaging 1.00
gingame UTSW 6 41670961 missense probably damaging 1.00
R0515:Trpv5 UTSW 6 41674211 intron probably benign
R1581:Trpv5 UTSW 6 41653140 missense probably damaging 1.00
R1633:Trpv5 UTSW 6 41675920 nonsense probably null
R1658:Trpv5 UTSW 6 41674282 missense probably damaging 1.00
R1677:Trpv5 UTSW 6 41657797 missense probably benign 0.44
R1955:Trpv5 UTSW 6 41657937 missense probably damaging 1.00
R2008:Trpv5 UTSW 6 41659728 critical splice acceptor site probably null
R2331:Trpv5 UTSW 6 41659968 missense probably damaging 1.00
R2519:Trpv5 UTSW 6 41674350 missense probably damaging 0.99
R2973:Trpv5 UTSW 6 41653231 missense possibly damaging 0.81
R2974:Trpv5 UTSW 6 41653231 missense possibly damaging 0.81
R3877:Trpv5 UTSW 6 41660343 missense probably benign 0.10
R3923:Trpv5 UTSW 6 41653249 missense probably benign 0.00
R4056:Trpv5 UTSW 6 41659705 missense probably damaging 1.00
R4396:Trpv5 UTSW 6 41657896 missense probably benign 0.00
R4757:Trpv5 UTSW 6 41653214 missense probably damaging 0.98
R5013:Trpv5 UTSW 6 41659713 missense probably damaging 1.00
R5330:Trpv5 UTSW 6 41660332 missense probably benign 0.06
R5331:Trpv5 UTSW 6 41660332 missense probably benign 0.06
R6270:Trpv5 UTSW 6 41674359 missense possibly damaging 0.94
R6405:Trpv5 UTSW 6 41674668 missense probably damaging 1.00
R6575:Trpv5 UTSW 6 41675969 missense probably benign
R6669:Trpv5 UTSW 6 41658042 missense probably damaging 1.00
R6681:Trpv5 UTSW 6 41653354 missense probably damaging 0.97
R6817:Trpv5 UTSW 6 41658007 missense possibly damaging 0.65
R7021:Trpv5 UTSW 6 41653270 missense probably benign 0.00
R7069:Trpv5 UTSW 6 41675960 missense possibly damaging 0.94
R7161:Trpv5 UTSW 6 41660536 nonsense probably null
R7241:Trpv5 UTSW 6 41675308 nonsense probably null
R7505:Trpv5 UTSW 6 41674656 missense probably damaging 0.99
R7806:Trpv5 UTSW 6 41674933 missense probably damaging 0.99
R8060:Trpv5 UTSW 6 41674531 nonsense probably null
R8407:Trpv5 UTSW 6 41675338 missense probably benign 0.02
R8428:Trpv5 UTSW 6 41653248 missense possibly damaging 0.48
R8435:Trpv5 UTSW 6 41670893 missense probably damaging 1.00
Z1177:Trpv5 UTSW 6 41674321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGGTCTGAGGGGCTCTGAG -3'
(R):5'- AACTGCTGAGGTGCTTCTGG -3'

Sequencing Primer
(F):5'- TCTGAGGGGCTCTGAGGAGAC -3'
(R):5'- CTGGAGCTAGGACTCTTTGGAAG -3'
Posted On2016-06-21