Incidental Mutation 'R5039:Ndufb7'
ID395705
Institutional Source Beutler Lab
Gene Symbol Ndufb7
Ensembl Gene ENSMUSG00000033938
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7
Synonyms
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5039 (G1)
Quality Score220
Status Validated
Chromosome8
Chromosomal Location83566671-83571626 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 83571465 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019382] [ENSMUST00000036996] [ENSMUST00000163837] [ENSMUST00000165740] [ENSMUST00000212005] [ENSMUST00000212630] [ENSMUST00000212703] [ENSMUST00000212990]
Predicted Effect probably benign
Transcript: ENSMUST00000019382
SMART Domains Protein: ENSMUSP00000019382
Gene: ENSMUSG00000031708

DomainStartEndE-ValueType
PDB:2DZJ|A 1 81 2e-49 PDB
Blast:UBQ 5 81 8e-13 BLAST
transmembrane domain 85 107 N/A INTRINSIC
Pfam:Steroid_dh 154 308 3.4e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000036996
AA Change: E105G
SMART Domains Protein: ENSMUSP00000037341
Gene: ENSMUSG00000033938
AA Change: E105G

DomainStartEndE-ValueType
Pfam:NDUF_B7 40 102 3.8e-32 PFAM
low complexity region 103 136 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127162
Predicted Effect probably benign
Transcript: ENSMUST00000163837
SMART Domains Protein: ENSMUSP00000128329
Gene: ENSMUSG00000031708

DomainStartEndE-ValueType
PDB:2DZJ|A 1 135 2e-27 PDB
Blast:UBQ 91 135 1e-7 BLAST
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Steroid_dh 208 362 6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165740
SMART Domains Protein: ENSMUSP00000131389
Gene: ENSMUSG00000031708

DomainStartEndE-ValueType
PDB:2DZJ|A 1 66 1e-31 PDB
transmembrane domain 70 92 N/A INTRINSIC
Pfam:Steroid_dh 139 293 3.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211972
Predicted Effect probably benign
Transcript: ENSMUST00000212005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212575
Predicted Effect probably benign
Transcript: ENSMUST00000212630
Predicted Effect probably benign
Transcript: ENSMUST00000212703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212652
Predicted Effect probably benign
Transcript: ENSMUST00000212990
Meta Mutation Damage Score 0.5594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It is located at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Ndufb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2204:Ndufb7 UTSW 8 83570899 missense probably damaging 1.00
R4603:Ndufb7 UTSW 8 83566865 missense probably damaging 0.98
R4620:Ndufb7 UTSW 8 83566858 missense probably damaging 0.99
R4916:Ndufb7 UTSW 8 83570905 missense probably damaging 1.00
R5120:Ndufb7 UTSW 8 83566977 unclassified probably benign
R5532:Ndufb7 UTSW 8 83571434 missense probably damaging 1.00
R5968:Ndufb7 UTSW 8 83566901 missense probably benign 0.03
R7117:Ndufb7 UTSW 8 83570861 missense probably benign 0.11
R7456:Ndufb7 UTSW 8 83566853 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCAGCTATCCACACCTCGGC -3'
(R):5'- TGAAGTTTAGGCAGGTGACC -3'

Sequencing Primer
(F):5'- CCACATGGGCATGGGAAG -3'
(R):5'- GCAGGTGACCCAAAGCTTTTATTTC -3'
Posted On2016-06-21