Incidental Mutation 'R5167:Nudt7'
ID397353
Institutional Source Beutler Lab
Gene Symbol Nudt7
Ensembl Gene ENSMUSG00000031767
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 7
Synonyms2210404C19Rik, 1300007B24Rik
MMRRC Submission 042747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5167 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location114133557-114154739 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 114151827 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 154 (C154*)
Ref Sequence ENSEMBL: ENSMUSP00000114598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066514] [ENSMUST00000073521] [ENSMUST00000109109] [ENSMUST00000134593] [ENSMUST00000147605]
Predicted Effect probably null
Transcript: ENSMUST00000066514
AA Change: C145*
SMART Domains Protein: ENSMUSP00000065791
Gene: ENSMUSG00000031767
AA Change: C145*

DomainStartEndE-ValueType
Pfam:NUDIX 15 140 4.1e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000073521
AA Change: C174*
SMART Domains Protein: ENSMUSP00000073213
Gene: ENSMUSG00000031767
AA Change: C174*

DomainStartEndE-ValueType
Pfam:NUDIX 38 168 4.4e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109109
AA Change: C198*
SMART Domains Protein: ENSMUSP00000104737
Gene: ENSMUSG00000031767
AA Change: C198*

DomainStartEndE-ValueType
Pfam:NUDIX 62 193 3.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134593
SMART Domains Protein: ENSMUSP00000116868
Gene: ENSMUSG00000031767

DomainStartEndE-ValueType
Pfam:NUDIX 38 146 4.2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147605
AA Change: C154*
SMART Domains Protein: ENSMUSP00000114598
Gene: ENSMUSG00000031767
AA Change: C154*

DomainStartEndE-ValueType
Pfam:NUDIX 38 107 1.2e-8 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Nudix hydrolase family. Nudix hydrolases eliminate potentially toxic nucleotide metabolites from the cell and regulate the concentrations and availability of many different nucleotide substrates, cofactors, and signaling molecules. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Calm3 T C 7: 16,917,701 D21G probably damaging Het
Cldn23 C T 8: 35,826,320 V5M possibly damaging Het
D630003M21Rik A G 2: 158,205,745 S735P probably damaging Het
Dscaml1 T C 9: 45,717,432 Y1095H probably damaging Het
Esr2 T C 12: 76,123,274 T427A probably benign Het
Fbxo28 T C 1: 182,317,993 I177V possibly damaging Het
Fubp1 T C 3: 152,221,352 L372P possibly damaging Het
Glis1 G A 4: 107,634,694 G585E probably damaging Het
Gm7258 T C 7: 128,596,067 noncoding transcript Het
Hecw1 C T 13: 14,285,657 R613Q probably damaging Het
Kif13b T C 14: 64,772,935 S1228P probably damaging Het
Knl1 A G 2: 119,070,031 I738V probably damaging Het
Lig1 T A 7: 13,311,058 V892D probably damaging Het
Lvrn T A 18: 46,880,747 Y499N probably damaging Het
Ly9 C A 1: 171,605,205 W80L probably damaging Het
Lypd5 T C 7: 24,352,464 V68A possibly damaging Het
Ngdn C T 14: 55,022,199 Q236* probably null Het
Olfr116 C A 17: 37,623,751 E295* probably null Het
Olfr1307 A T 2: 111,945,102 M118K probably damaging Het
Olfr1472 T A 19: 13,454,377 I47F probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pcnt G T 10: 76,420,424 Q661K probably damaging Het
Plekha1 G A 7: 130,885,449 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Rac3 A G 11: 120,722,595 D58G probably null Het
Rgl2 C T 17: 33,935,974 R203* probably null Het
Rnf219 A G 14: 104,478,787 S717P probably damaging Het
Ryr1 T C 7: 29,067,693 D2948G probably damaging Het
Serpina12 A T 12: 104,037,920 L151Q probably damaging Het
Sf3a1 T C 11: 4,177,456 V594A possibly damaging Het
Spdl1 G T 11: 34,813,360 H549N possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Zfp352 A G 4: 90,224,216 T198A possibly damaging Het
Other mutations in Nudt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Nudt7 APN 8 114147885 splice site probably benign
IGL02549:Nudt7 APN 8 114151948 missense probably damaging 1.00
R0525:Nudt7 UTSW 8 114151652 critical splice acceptor site probably null
R0781:Nudt7 UTSW 8 114135371 intron probably benign
R5198:Nudt7 UTSW 8 114135445 splice site probably null
R5562:Nudt7 UTSW 8 114147983 missense probably damaging 1.00
R5597:Nudt7 UTSW 8 114151766 missense probably benign 0.12
R6957:Nudt7 UTSW 8 114133645 missense probably benign 0.03
R7410:Nudt7 UTSW 8 114133819 intron probably benign
Predicted Primers PCR Primer
(F):5'- GAATGATGCACTGGTAACCCC -3'
(R):5'- AAAACCTCATGTACGTTCTTTTGGG -3'

Sequencing Primer
(F):5'- CCGTAGTGGGTTTTCTAGACCAC -3'
(R):5'- CAGGGTCTTCACAACTTGCTTAAAG -3'
Posted On2016-07-06