Incidental Mutation 'R5167:Olfr1472'
ID 397371
Institutional Source Beutler Lab
Gene Symbol Olfr1472
Ensembl Gene ENSMUSG00000095189
Gene Name olfactory receptor 1472
Synonyms GA_x6K02T2RE5P-3787124-3786180, MOR202-16
MMRRC Submission 042747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R5167 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 13453280-13456086 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13454377 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 47 (I47F)
Ref Sequence ENSEMBL: ENSMUSP00000093915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077501] [ENSMUST00000096201]
AlphaFold Q7TQQ9
Predicted Effect probably damaging
Transcript: ENSMUST00000077501
AA Change: I47F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076707
Gene: ENSMUSG00000095189
AA Change: I47F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 303 5.2e-8 PFAM
Pfam:7tm_1 39 288 6.9e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096201
AA Change: I47F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093915
Gene: ENSMUSG00000095189
AA Change: I47F

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 3.9e-53 PFAM
Pfam:7TM_GPCR_Srsx 34 304 2.6e-6 PFAM
Pfam:7tm_1 40 289 1.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213561
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Calm3 T C 7: 16,917,701 D21G probably damaging Het
Cldn23 C T 8: 35,826,320 V5M possibly damaging Het
D630003M21Rik A G 2: 158,205,745 S735P probably damaging Het
Dscaml1 T C 9: 45,717,432 Y1095H probably damaging Het
Esr2 T C 12: 76,123,274 T427A probably benign Het
Fbxo28 T C 1: 182,317,993 I177V possibly damaging Het
Fubp1 T C 3: 152,221,352 L372P possibly damaging Het
Glis1 G A 4: 107,634,694 G585E probably damaging Het
Gm7258 T C 7: 128,596,067 noncoding transcript Het
Hecw1 C T 13: 14,285,657 R613Q probably damaging Het
Kif13b T C 14: 64,772,935 S1228P probably damaging Het
Knl1 A G 2: 119,070,031 I738V probably damaging Het
Lig1 T A 7: 13,311,058 V892D probably damaging Het
Lvrn T A 18: 46,880,747 Y499N probably damaging Het
Ly9 C A 1: 171,605,205 W80L probably damaging Het
Lypd5 T C 7: 24,352,464 V68A possibly damaging Het
Ngdn C T 14: 55,022,199 Q236* probably null Het
Nudt7 C A 8: 114,151,827 C154* probably null Het
Olfr116 C A 17: 37,623,751 E295* probably null Het
Olfr1307 A T 2: 111,945,102 M118K probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pcnt G T 10: 76,420,424 Q661K probably damaging Het
Plekha1 G A 7: 130,885,449 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Rac3 A G 11: 120,722,595 D58G probably null Het
Rgl2 C T 17: 33,935,974 R203* probably null Het
Rnf219 A G 14: 104,478,787 S717P probably damaging Het
Ryr1 T C 7: 29,067,693 D2948G probably damaging Het
Serpina12 A T 12: 104,037,920 L151Q probably damaging Het
Sf3a1 T C 11: 4,177,456 V594A possibly damaging Het
Spdl1 G T 11: 34,813,360 H549N possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Zfp352 A G 4: 90,224,216 T198A possibly damaging Het
Other mutations in Olfr1472
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Olfr1472 APN 19 13453840 missense possibly damaging 0.46
IGL01755:Olfr1472 APN 19 13453815 missense probably damaging 1.00
IGL01885:Olfr1472 APN 19 13454085 missense probably benign 0.00
IGL02366:Olfr1472 APN 19 13454127 missense probably damaging 1.00
IGL03074:Olfr1472 APN 19 13454053 missense probably damaging 0.98
R0592:Olfr1472 UTSW 19 13453705 missense probably benign 0.00
R1085:Olfr1472 UTSW 19 13454230 missense possibly damaging 0.75
R4207:Olfr1472 UTSW 19 13454471 missense probably benign 0.15
R4856:Olfr1472 UTSW 19 13454521 splice site probably null
R4886:Olfr1472 UTSW 19 13454521 splice site probably null
R5061:Olfr1472 UTSW 19 13453985 nonsense probably null
R5509:Olfr1472 UTSW 19 13453968 missense probably damaging 1.00
R5586:Olfr1472 UTSW 19 13454382 missense probably benign 0.02
R5987:Olfr1472 UTSW 19 13453960 missense possibly damaging 0.57
R6631:Olfr1472 UTSW 19 13453821 missense probably benign 0.00
R7976:Olfr1472 UTSW 19 13454199 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGCACACTGCTGCATGAC -3'
(R):5'- CTAGGAACTTGTCATGATAATTGCC -3'

Sequencing Primer
(F):5'- ACTGCTGCATGACGGTCATAG -3'
(R):5'- ACTTGTCATGATAATTGCCAAATAAC -3'
Posted On 2016-07-06