Incidental Mutation 'R5167:Spdl1'
ID397357
Institutional Source Beutler Lab
Gene Symbol Spdl1
Ensembl Gene ENSMUSG00000069910
Gene Namespindle apparatus coiled-coil protein 1
Synonyms
MMRRC Submission 042747-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R5167 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location34809190-34833641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34813360 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 549 (H549N)
Ref Sequence ENSEMBL: ENSMUSP00000090882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093191]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093191
AA Change: H549N

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090882
Gene: ENSMUSG00000069910
AA Change: H549N

DomainStartEndE-ValueType
coiled coil region 35 342 N/A INTRINSIC
coiled coil region 370 441 N/A INTRINSIC
low complexity region 463 478 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Calm3 T C 7: 16,917,701 D21G probably damaging Het
Cldn23 C T 8: 35,826,320 V5M possibly damaging Het
D630003M21Rik A G 2: 158,205,745 S735P probably damaging Het
Dscaml1 T C 9: 45,717,432 Y1095H probably damaging Het
Esr2 T C 12: 76,123,274 T427A probably benign Het
Fbxo28 T C 1: 182,317,993 I177V possibly damaging Het
Fubp1 T C 3: 152,221,352 L372P possibly damaging Het
Glis1 G A 4: 107,634,694 G585E probably damaging Het
Gm7258 T C 7: 128,596,067 noncoding transcript Het
Hecw1 C T 13: 14,285,657 R613Q probably damaging Het
Kif13b T C 14: 64,772,935 S1228P probably damaging Het
Knl1 A G 2: 119,070,031 I738V probably damaging Het
Lig1 T A 7: 13,311,058 V892D probably damaging Het
Lvrn T A 18: 46,880,747 Y499N probably damaging Het
Ly9 C A 1: 171,605,205 W80L probably damaging Het
Lypd5 T C 7: 24,352,464 V68A possibly damaging Het
Ngdn C T 14: 55,022,199 Q236* probably null Het
Nudt7 C A 8: 114,151,827 C154* probably null Het
Olfr116 C A 17: 37,623,751 E295* probably null Het
Olfr1307 A T 2: 111,945,102 M118K probably damaging Het
Olfr1472 T A 19: 13,454,377 I47F probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pcnt G T 10: 76,420,424 Q661K probably damaging Het
Plekha1 G A 7: 130,885,449 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Rac3 A G 11: 120,722,595 D58G probably null Het
Rgl2 C T 17: 33,935,974 R203* probably null Het
Rnf219 A G 14: 104,478,787 S717P probably damaging Het
Ryr1 T C 7: 29,067,693 D2948G probably damaging Het
Serpina12 A T 12: 104,037,920 L151Q probably damaging Het
Sf3a1 T C 11: 4,177,456 V594A possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Zfp352 A G 4: 90,224,216 T198A possibly damaging Het
Other mutations in Spdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Spdl1 APN 11 34813354 missense probably benign 0.27
IGL02694:Spdl1 APN 11 34813621 missense probably benign 0.05
IGL03131:Spdl1 APN 11 34830765 missense possibly damaging 0.46
R0295:Spdl1 UTSW 11 34813343 missense possibly damaging 0.82
R0319:Spdl1 UTSW 11 34823520 missense possibly damaging 0.66
R1017:Spdl1 UTSW 11 34819290 missense possibly damaging 0.66
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1296:Spdl1 UTSW 11 34813607 missense unknown
R1315:Spdl1 UTSW 11 34813407 missense unknown
R1799:Spdl1 UTSW 11 34821029 nonsense probably null
R2002:Spdl1 UTSW 11 34822646 missense probably benign
R2291:Spdl1 UTSW 11 34819309 nonsense probably null
R4771:Spdl1 UTSW 11 34813327 missense probably damaging 0.98
R5030:Spdl1 UTSW 11 34823440 missense probably benign 0.00
R5477:Spdl1 UTSW 11 34822210 missense possibly damaging 0.66
R6258:Spdl1 UTSW 11 34819886 missense probably damaging 0.97
R6260:Spdl1 UTSW 11 34819886 missense probably damaging 0.97
R6554:Spdl1 UTSW 11 34822570 missense possibly damaging 0.82
R6695:Spdl1 UTSW 11 34823003 intron probably null
R6714:Spdl1 UTSW 11 34823003 intron probably null
R6980:Spdl1 UTSW 11 34830879 start codon destroyed probably null 0.04
R7355:Spdl1 UTSW 11 34823364 missense not run
R7791:Spdl1 UTSW 11 34813477 missense possibly damaging 0.83
R7844:Spdl1 UTSW 11 34813343 missense possibly damaging 0.82
R7927:Spdl1 UTSW 11 34813343 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACACAGTGCTCAGACTGCAG -3'
(R):5'- GAGGAGGAATCCTGTCTTAATAGC -3'

Sequencing Primer
(F):5'- AGACTGCAGAGCTCCAGTG -3'
(R):5'- AGCTTAAAAGATAACACTGTGCAG -3'
Posted On2016-07-06