Mutagenetix > Incidental Mutations

Incidental Mutation 'R5167:Spdl1'

397357

Institutional Source

Beutler Lab

Gene Symbol

Spdl1

Ensembl Gene

ENSMUSG00000069910

Gene Name

spindle apparatus coiled-coil protein 1

Synonyms

MMRRC Submission

042747-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.932) question?

Stock #

R5167 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34809190-34833641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 34813360 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 549 (H549N)

Ref Sequence

ENSEMBL: ENSMUSP00000090882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093191]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093191
AA Change: H549N

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000090882
Gene: ENSMUSG00000069910
AA Change: H549N

Domain	Start	End	E-Value	Type
coiled coil region	35	342	N/A	INTRINSIC
coiled coil region	370	441	N/A	INTRINSIC
low complexity region	463	478	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,812,656	Y113N	probably damaging	Het
Bcan	G	T	3: 87,994,207	S396Y	probably damaging	Het
Calm3	T	C	7: 16,917,701	D21G	probably damaging	Het
Cldn23	C	T	8: 35,826,320	V5M	possibly damaging	Het
D630003M21Rik	A	G	2: 158,205,745	S735P	probably damaging	Het
Dscaml1	T	C	9: 45,717,432	Y1095H	probably damaging	Het
Esr2	T	C	12: 76,123,274	T427A	probably benign	Het
Fbxo28	T	C	1: 182,317,993	I177V	possibly damaging	Het
Fubp1	T	C	3: 152,221,352	L372P	possibly damaging	Het
Glis1	G	A	4: 107,634,694	G585E	probably damaging	Het
Gm7258	T	C	7: 128,596,067		noncoding transcript	Het
Hecw1	C	T	13: 14,285,657	R613Q	probably damaging	Het
Kif13b	T	C	14: 64,772,935	S1228P	probably damaging	Het
Knl1	A	G	2: 119,070,031	I738V	probably damaging	Het
Lig1	T	A	7: 13,311,058	V892D	probably damaging	Het
Lvrn	T	A	18: 46,880,747	Y499N	probably damaging	Het
Ly9	C	A	1: 171,605,205	W80L	probably damaging	Het
Lypd5	T	C	7: 24,352,464	V68A	possibly damaging	Het
Ngdn	C	T	14: 55,022,199	Q236*	probably null	Het
Nudt7	C	A	8: 114,151,827	C154*	probably null	Het
Olfr116	C	A	17: 37,623,751	E295*	probably null	Het
Olfr1307	A	T	2: 111,945,102	M118K	probably damaging	Het
Olfr1472	T	A	19: 13,454,377	I47F	probably damaging	Het
Paxbp1	A	G	16: 91,022,667		probably null	Het
Pcnt	G	T	10: 76,420,424	Q661K	probably damaging	Het
Plekha1	G	A	7: 130,885,449		probably null	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Rac3	A	G	11: 120,722,595	D58G	probably null	Het
Rgl2	C	T	17: 33,935,974	R203*	probably null	Het
Rnf219	A	G	14: 104,478,787	S717P	probably damaging	Het
Ryr1	T	C	7: 29,067,693	D2948G	probably damaging	Het
Serpina12	A	T	12: 104,037,920	L151Q	probably damaging	Het
Sf3a1	T	C	11: 4,177,456	V594A	possibly damaging	Het
Srp68	C	A	11: 116,265,474	E147D	probably damaging	Het
Zfp352	A	G	4: 90,224,216	T198A	possibly damaging	Het

Other mutations in Spdl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02417:Spdl1	APN	11	34813354	missense	probably benign	0.27
IGL02694:Spdl1	APN	11	34813621	missense	probably benign	0.05
IGL03131:Spdl1	APN	11	34830765	missense	possibly damaging	0.46
R0295:Spdl1	UTSW	11	34813343	missense	possibly damaging	0.82
R0319:Spdl1	UTSW	11	34823520	missense	possibly damaging	0.66
R1017:Spdl1	UTSW	11	34819290	missense	possibly damaging	0.66
R1195:Spdl1	UTSW	11	34819817	missense	probably damaging	0.97
R1195:Spdl1	UTSW	11	34819817	missense	probably damaging	0.97
R1195:Spdl1	UTSW	11	34819817	missense	probably damaging	0.97
R1296:Spdl1	UTSW	11	34813607	missense	unknown
R1315:Spdl1	UTSW	11	34813407	missense	unknown
R1799:Spdl1	UTSW	11	34821029	nonsense	probably null
R2002:Spdl1	UTSW	11	34822646	missense	probably benign
R2291:Spdl1	UTSW	11	34819309	nonsense	probably null
R4771:Spdl1	UTSW	11	34813327	missense	probably damaging	0.98
R5030:Spdl1	UTSW	11	34823440	missense	probably benign	0.00
R5477:Spdl1	UTSW	11	34822210	missense	possibly damaging	0.66
R6258:Spdl1	UTSW	11	34819886	missense	probably damaging	0.97
R6260:Spdl1	UTSW	11	34819886	missense	probably damaging	0.97
R6554:Spdl1	UTSW	11	34822570	missense	possibly damaging	0.82
R6695:Spdl1	UTSW	11	34823003	intron	probably null
R6714:Spdl1	UTSW	11	34823003	intron	probably null
R6980:Spdl1	UTSW	11	34830879	start codon destroyed	probably null	0.04
R7355:Spdl1	UTSW	11	34823364	missense	not run
R7791:Spdl1	UTSW	11	34813477	missense	possibly damaging	0.83
R7844:Spdl1	UTSW	11	34813343	missense	possibly damaging	0.82
R7927:Spdl1	UTSW	11	34813343	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- ACACAGTGCTCAGACTGCAG -3'
(R):5'- GAGGAGGAATCCTGTCTTAATAGC -3'

Sequencing Primer
(F):5'- AGACTGCAGAGCTCCAGTG -3'
(R):5'- AGCTTAAAAGATAACACTGTGCAG -3'

Posted On

2016-07-06