Incidental Mutation 'R5271:Ptpdc1'
ID 400342
Institutional Source Beutler Lab
Gene Symbol Ptpdc1
Ensembl Gene ENSMUSG00000038042
Gene Name protein tyrosine phosphatase domain containing 1
Synonyms
MMRRC Submission 042861-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5271 (G1)
Quality Score 203
Status Validated
Chromosome 13
Chromosomal Location 48577872-48625664 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48590698 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 149 (D149G)
Ref Sequence ENSEMBL: ENSMUSP00000152771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035824] [ENSMUST00000222028] [ENSMUST00000223025]
AlphaFold Q6NZK8
Predicted Effect probably damaging
Transcript: ENSMUST00000035824
AA Change: D88G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047374
Gene: ENSMUSG00000038042
AA Change: D88G

DomainStartEndE-ValueType
Pfam:DSPc 102 243 1.1e-13 PFAM
Pfam:Y_phosphatase 144 242 8.9e-10 PFAM
low complexity region 598 610 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221947
Predicted Effect probably damaging
Transcript: ENSMUST00000222028
AA Change: D149G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000223025
AA Change: T66A
Meta Mutation Damage Score 0.1678 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: The protein encoded by this gene is a centrosomal mitotic phosphatase. This protein has been implicated in centrosomal duplication and cytokinesis. In addition, knockdown of expression levels in non-cycling cells results in extra long cilia, suggesting that this protein may function in regulating cilia length independent of a function in cell cycle control. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,847 K33R possibly damaging Het
4632415L05Rik C T 3: 19,895,147 noncoding transcript Het
4930542C16Rik A C 14: 24,615,530 noncoding transcript Het
Adprh A T 16: 38,446,054 L242* probably null Het
Anapc1 G A 2: 128,685,985 Q18* probably null Het
Bfar T C 16: 13,692,397 probably benign Het
Bmp1 T C 14: 70,508,128 I206V probably benign Het
Cc2d1b T A 4: 108,623,629 probably benign Het
Clock A G 5: 76,241,954 I349T probably damaging Het
Cox11 A G 11: 90,643,732 Y60C probably damaging Het
Cyp1a1 G A 9: 57,702,838 V512M probably benign Het
Dcdc2a T C 13: 25,187,688 F311S probably benign Het
Dnase1l3 T C 14: 7,993,843 D48G probably damaging Het
Engase G T 11: 118,481,397 A172S probably damaging Het
F2 T C 2: 91,635,121 probably benign Het
Gcc2 T C 10: 58,269,695 V215A possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm14548 A T 7: 3,897,567 Y61* probably null Het
Gm20388 A G 8: 122,271,133 probably benign Het
Gm20671 T C 5: 32,819,959 K1817R possibly damaging Het
Gm20939 T A 17: 94,877,155 Y410* probably null Het
Gm27013 T C 6: 130,676,915 Y528C probably damaging Het
Gm9992 T C 17: 7,369,682 N149S possibly damaging Het
Il23r T C 6: 67,423,696 H550R probably benign Het
Iqgap1 A T 7: 80,734,148 V1056E probably damaging Het
Lrit3 T A 3: 129,788,301 Y679F probably damaging Het
Megf8 A T 7: 25,341,706 E1120V probably damaging Het
Mta1 A G 12: 113,131,957 E518G probably damaging Het
Myo9a A G 9: 59,907,382 I2200M probably damaging Het
Ncoa7 T C 10: 30,722,729 H66R probably benign Het
Ncor1 A G 11: 62,340,545 V812A probably damaging Het
Ndnf T C 6: 65,703,666 Y310H possibly damaging Het
Ndst1 G A 18: 60,705,132 T347I probably benign Het
Olfr1229 A T 2: 89,282,953 F60Y probably benign Het
Olfr512 T C 7: 108,714,217 L276S probably damaging Het
Pcdhb10 C A 18: 37,413,169 Q433K probably benign Het
Pcdhb18 G A 18: 37,491,596 V660M possibly damaging Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Polk T C 13: 96,483,539 S718G probably benign Het
Rb1cc1 T A 1: 6,249,193 C35* probably null Het
Samd9l C T 6: 3,376,156 M368I probably benign Het
Shroom3 T C 5: 92,962,248 M1739T probably damaging Het
Slc18a3 A G 14: 32,463,748 L226P probably damaging Het
St7l A T 3: 104,868,060 Y84F probably damaging Het
Svil A T 18: 5,062,329 N392I probably benign Het
Syngr1 T A 15: 80,098,039 M9K probably benign Het
Taar2 T C 10: 23,941,032 S157P probably damaging Het
Tagap1 G T 17: 6,956,096 Y400* probably null Het
Tbc1d8 T A 1: 39,373,767 E976V probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Tnfaip2 A G 12: 111,448,460 probably benign Het
Ttn C T 2: 76,706,517 S34988N possibly damaging Het
Tubg1 T G 11: 101,120,238 N15K probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zap70 T A 1: 36,781,365 V547D probably damaging Het
Zfp146 G T 7: 30,162,475 N47K probably benign Het
Znrf1 T G 8: 111,609,344 M159R probably benign Het
Other mutations in Ptpdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Ptpdc1 APN 13 48587058 missense possibly damaging 0.80
IGL01410:Ptpdc1 APN 13 48586604 missense probably damaging 0.99
IGL02931:Ptpdc1 APN 13 48590619 splice site probably benign
IGL03180:Ptpdc1 APN 13 48586077 missense probably damaging 1.00
PIT4519001:Ptpdc1 UTSW 13 48583156 missense probably benign 0.29
PIT4687001:Ptpdc1 UTSW 13 48586290 missense probably benign 0.15
R0014:Ptpdc1 UTSW 13 48586919 nonsense probably null
R0244:Ptpdc1 UTSW 13 48585980 missense probably benign 0.00
R0420:Ptpdc1 UTSW 13 48589119 critical splice donor site probably null
R0690:Ptpdc1 UTSW 13 48586905 missense probably benign 0.33
R0946:Ptpdc1 UTSW 13 48586810 missense probably damaging 1.00
R1076:Ptpdc1 UTSW 13 48586810 missense probably damaging 1.00
R1387:Ptpdc1 UTSW 13 48586320 missense possibly damaging 0.85
R1459:Ptpdc1 UTSW 13 48586697 missense possibly damaging 0.62
R1688:Ptpdc1 UTSW 13 48586224 missense probably benign 0.28
R1732:Ptpdc1 UTSW 13 48586545 missense probably benign 0.00
R2097:Ptpdc1 UTSW 13 48592659 critical splice acceptor site probably null
R2570:Ptpdc1 UTSW 13 48586063 missense probably benign 0.02
R3950:Ptpdc1 UTSW 13 48589194 missense probably damaging 1.00
R4260:Ptpdc1 UTSW 13 48579758 missense probably benign 0.33
R5194:Ptpdc1 UTSW 13 48586789 missense possibly damaging 0.91
R5894:Ptpdc1 UTSW 13 48590322 missense probably damaging 1.00
R5934:Ptpdc1 UTSW 13 48586369 missense probably benign 0.08
R6894:Ptpdc1 UTSW 13 48590638 missense probably benign 0.21
R7056:Ptpdc1 UTSW 13 48586990 missense possibly damaging 0.65
R7436:Ptpdc1 UTSW 13 48586666 missense probably benign 0.01
R7719:Ptpdc1 UTSW 13 48586290 missense probably benign 0.15
R7827:Ptpdc1 UTSW 13 48579788 missense probably damaging 1.00
R7969:Ptpdc1 UTSW 13 48587101 missense probably damaging 1.00
R7986:Ptpdc1 UTSW 13 48592570 missense probably damaging 1.00
R8330:Ptpdc1 UTSW 13 48597914 missense probably benign 0.00
R8500:Ptpdc1 UTSW 13 48586283 nonsense probably null
R8687:Ptpdc1 UTSW 13 48586660 missense possibly damaging 0.90
R8874:Ptpdc1 UTSW 13 48590692 missense probably damaging 1.00
R9130:Ptpdc1 UTSW 13 48586179 missense probably benign 0.04
R9284:Ptpdc1 UTSW 13 48586691 missense probably benign 0.04
R9290:Ptpdc1 UTSW 13 48586745 missense probably benign 0.02
R9309:Ptpdc1 UTSW 13 48583131 missense probably benign 0.00
R9359:Ptpdc1 UTSW 13 48586554 missense probably benign 0.38
R9369:Ptpdc1 UTSW 13 48583246 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAATCAGCTCTTCACTGCCCG -3'
(R):5'- TTGTCAGAATCCTTAGGTCCTG -3'

Sequencing Primer
(F):5'- TCAGCTCAAGAAGAGCAC -3'
(R):5'- TCCCAGGGATTTAAGGAGCTG -3'
Posted On 2016-07-06