Incidental Mutation 'R5272:Tgif1'
List |< first << previous [record 36 of 45] next >> last >|
ID400451
Institutional Source Beutler Lab
Gene Symbol Tgif1
Ensembl Gene ENSMUSG00000047407
Gene NameTGFB-induced factor homeobox 1
SynonymsTgif
MMRRC Submission 042836-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5272 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location70844205-70853546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70846254 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 34 (L34P)
Ref Sequence ENSEMBL: ENSMUSP00000127139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059775] [ENSMUST00000118283] [ENSMUST00000127719] [ENSMUST00000134654] [ENSMUST00000135007] [ENSMUST00000166395] [ENSMUST00000172229] [ENSMUST00000186358]
Predicted Effect probably damaging
Transcript: ENSMUST00000059775
AA Change: L54P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060512
Gene: ENSMUSG00000047407
AA Change: L54P

DomainStartEndE-ValueType
HOX 35 100 1.53e-13 SMART
low complexity region 117 126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118283
AA Change: L34P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113192
Gene: ENSMUSG00000047407
AA Change: L34P

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125329
Predicted Effect probably damaging
Transcript: ENSMUST00000127719
AA Change: L34P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115375
Gene: ENSMUSG00000047407
AA Change: L34P

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132825
Predicted Effect unknown
Transcript: ENSMUST00000134654
AA Change: L34P
SMART Domains Protein: ENSMUSP00000125247
Gene: ENSMUSG00000047407
AA Change: L34P

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Pfam:Homeobox_KN 33 58 7.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135007
AA Change: L34P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124168
Gene: ENSMUSG00000047407
AA Change: L34P

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156484
AA Change: L24P
SMART Domains Protein: ENSMUSP00000124970
Gene: ENSMUSG00000047407
AA Change: L24P

DomainStartEndE-ValueType
HOX 6 57 2.23e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166395
AA Change: L87P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130930
Gene: ENSMUSG00000047407
AA Change: L87P

DomainStartEndE-ValueType
HOX 68 133 1.53e-13 SMART
low complexity region 150 159 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172229
AA Change: L34P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127139
Gene: ENSMUSG00000047407
AA Change: L34P

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186358
AA Change: L54P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139438
Gene: ENSMUSG00000047407
AA Change: L54P

DomainStartEndE-ValueType
HOX 35 84 1.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190687
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice display normal growth, behavior and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A G 3: 32,718,610 E245G probably damaging Het
Arsb A T 13: 93,794,162 T213S possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Cep152 G A 2: 125,611,030 T374I probably benign Het
Crx C T 7: 15,868,285 C156Y probably damaging Het
Csmd1 T A 8: 16,199,944 T1007S probably damaging Het
Cyp19a1 A T 9: 54,176,614 C164S probably benign Het
Ddx55 A T 5: 124,558,029 I137F possibly damaging Het
Dgkg C A 16: 22,588,294 probably null Het
Dicer1 A G 12: 104,704,240 I1022T probably damaging Het
Dis3l2 T C 1: 86,973,404 V439A possibly damaging Het
Dnah5 T C 15: 28,350,665 V2611A probably benign Het
Dnah6 A G 6: 73,127,861 probably null Het
Ercc6 A T 14: 32,519,028 K170* probably null Het
Fibcd1 A T 2: 31,816,623 C399S probably damaging Het
Fibcd1 G T 2: 31,816,624 N398K probably damaging Het
Fnbp4 G A 2: 90,753,115 M327I probably benign Het
Fryl A T 5: 73,065,136 L256* probably null Het
Galr1 T A 18: 82,405,636 Y172F probably benign Het
Gpi1 T C 7: 34,220,690 N186S probably damaging Het
Kcnh8 A G 17: 52,905,015 I614V probably damaging Het
Krt23 A T 11: 99,478,273 I398N probably damaging Het
Mia3 G A 1: 183,328,270 R656* probably null Het
Mup6 G C 4: 60,005,922 G138A probably damaging Het
Nectin3 A G 16: 46,448,476 V521A possibly damaging Het
Nphs1 A G 7: 30,481,642 E1096G possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Panx1 C T 9: 15,044,856 probably null Het
Pcdhb4 A G 18: 37,307,766 Y43C probably benign Het
Plbd1 A G 6: 136,640,158 Y62H probably damaging Het
Rab40b A G 11: 121,357,308 V190A probably damaging Het
Ryr3 T C 2: 112,653,213 E4063G probably damaging Het
Smlr1 T C 10: 25,536,027 I21V probably benign Het
Tenm4 T A 7: 96,874,203 Y1614N probably damaging Het
Tesmin C A 19: 3,406,992 A257E probably damaging Het
Ticrr C A 7: 79,669,605 T446K probably benign Het
Tmc7 A G 7: 118,561,053 I187T probably benign Het
Tpst2 T A 5: 112,307,952 V119E probably damaging Het
Trf A T 9: 103,227,978 M45K probably damaging Het
Trim45 T C 3: 100,929,919 C524R probably damaging Het
Ttc27 G A 17: 74,742,977 V293I probably damaging Het
Ugt1a6b C T 1: 88,107,227 R96C possibly damaging Het
Vit A G 17: 78,586,835 Q222R probably benign Het
Zfp148 T A 16: 33,496,224 V380D probably damaging Het
Other mutations in Tgif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Tgif1 APN 17 70846240 missense probably damaging 1.00
IGL03169:Tgif1 APN 17 70844841 missense possibly damaging 0.93
IGL03179:Tgif1 APN 17 70844947 missense possibly damaging 0.80
R0050:Tgif1 UTSW 17 70850884 missense probably damaging 1.00
R4569:Tgif1 UTSW 17 70844917 missense possibly damaging 0.51
R4877:Tgif1 UTSW 17 70849705 utr 5 prime probably null
R4914:Tgif1 UTSW 17 70845247 missense probably damaging 1.00
R4985:Tgif1 UTSW 17 70844872 missense probably benign 0.02
R5760:Tgif1 UTSW 17 70845001 missense probably damaging 1.00
R6270:Tgif1 UTSW 17 70844866 unclassified probably null
R6528:Tgif1 UTSW 17 70846560 intron probably benign
R6693:Tgif1 UTSW 17 70850890 start gained probably benign
R7231:Tgif1 UTSW 17 70846173 missense probably damaging 1.00
R7319:Tgif1 UTSW 17 70844852 missense probably damaging 0.99
R7776:Tgif1 UTSW 17 70851457 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCACACAGGAATGCTATAAATTGTC -3'
(R):5'- GTTTCCCTGCTGGTGAAAGC -3'

Sequencing Primer
(F):5'- AAAGTGTATGTATAGGTTAGGGGC -3'
(R):5'- CTGGTGAAAGCAAGTGACCGC -3'
Posted On2016-07-06