Incidental Mutation 'R5200:Shc3'
ID400720
Institutional Source Beutler Lab
Gene Symbol Shc3
Ensembl Gene ENSMUSG00000021448
Gene Namesrc homology 2 domain-containing transforming protein C3
SynonymsRai, ShcC, N-Shc
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R5200 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location51431041-51569419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51516565 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 49 (M49V)
Ref Sequence ENSEMBL: ENSMUSP00000152080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021898] [ENSMUST00000223543]
Predicted Effect probably damaging
Transcript: ENSMUST00000021898
AA Change: M49V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021898
Gene: ENSMUSG00000021448
AA Change: M49V

DomainStartEndE-ValueType
PTB 30 194 5.36e-41 SMART
SH2 377 456 6.38e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223543
AA Change: M49V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,960,734 V497A probably benign Het
Alx3 T C 3: 107,600,664 F163S possibly damaging Het
Ankmy1 T C 1: 92,870,292 R997G probably benign Het
Arfgef2 T C 2: 166,860,684 S848P probably benign Het
Atp11b A G 3: 35,837,007 I810V probably benign Het
C1ql4 T G 15: 99,084,837 I212L probably benign Het
Cep63 T C 9: 102,598,188 Y443C probably benign Het
Cfap45 C T 1: 172,545,129 Q464* probably null Het
Clcn3 T C 8: 60,923,005 K618R probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dyx1c1 T C 9: 72,972,431 S418P probably damaging Het
Fam208a A G 14: 27,429,226 E53G probably benign Het
H2-M10.2 T G 17: 36,284,749 R216S probably benign Het
Hook1 A G 4: 95,993,130 D113G probably damaging Het
Ift122 A G 6: 115,920,379 E914G probably damaging Het
Insr A G 8: 3,198,059 probably null Het
Itpr2 A T 6: 146,144,107 probably null Het
Myo6 C T 9: 80,276,374 Q684* probably null Het
Nrde2 T A 12: 100,130,497 I1015F possibly damaging Het
Olfr1121 T A 2: 87,372,102 V190E probably damaging Het
Olfr710 G A 7: 106,944,980 T7I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa A T 4: 65,155,839 N210I probably damaging Het
Pax4 G A 6: 28,445,139 P179L probably damaging Het
Pcx G A 19: 4,618,504 D656N probably damaging Het
Pms1 T A 1: 53,206,757 H541L probably benign Het
Pten C T 19: 32,799,891 P95L probably damaging Het
Rsrc2 G A 5: 123,739,499 R140* probably null Het
Snap91 C G 9: 86,815,444 K288N probably damaging Het
Spag17 C T 3: 100,063,471 Q1324* probably null Het
Tfr2 A G 5: 137,570,980 probably benign Het
Tgfbrap1 A T 1: 43,075,643 I99K probably damaging Het
Tmem38a T A 8: 72,580,034 V119E probably damaging Het
Tmtc4 T G 14: 122,945,557 D243A probably benign Het
Tnc A T 4: 63,971,278 S1755T probably damaging Het
Trim67 T C 8: 124,824,850 S590P probably damaging Het
Ttn T A 2: 76,759,943 T12814S probably damaging Het
Uspl1 T A 5: 149,214,113 S708T probably benign Het
Vmn2r69 A T 7: 85,406,509 F807Y probably damaging Het
Vmn2r97 C T 17: 18,928,353 P170L probably damaging Het
Zfp612 C T 8: 110,089,900 Q580* probably null Het
Other mutations in Shc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Shc3 APN 13 51461343 missense probably damaging 0.98
IGL00914:Shc3 APN 13 51480227 splice site probably benign
IGL01417:Shc3 APN 13 51431164 missense probably benign 0.10
IGL01536:Shc3 APN 13 51516559 missense probably damaging 1.00
Massless UTSW 13 51442973 missense possibly damaging 0.92
Singularity UTSW 13 51442820 intron probably null
R0499:Shc3 UTSW 13 51480228 splice site probably benign
R0941:Shc3 UTSW 13 51480206 missense probably benign
R1652:Shc3 UTSW 13 51472839 missense probably damaging 0.99
R1739:Shc3 UTSW 13 51482916 missense probably damaging 0.97
R1750:Shc3 UTSW 13 51449292 missense probably damaging 1.00
R1817:Shc3 UTSW 13 51472852 missense possibly damaging 0.93
R1848:Shc3 UTSW 13 51461388 missense probably damaging 1.00
R1991:Shc3 UTSW 13 51442836 missense probably benign 0.01
R2103:Shc3 UTSW 13 51442836 missense probably benign 0.01
R4426:Shc3 UTSW 13 51480094 splice site probably null
R4434:Shc3 UTSW 13 51449266 missense probably benign 0.00
R4823:Shc3 UTSW 13 51451570 missense probably benign
R4933:Shc3 UTSW 13 51442769 missense probably benign 0.03
R4998:Shc3 UTSW 13 51442820 intron probably null
R5153:Shc3 UTSW 13 51461377 missense probably damaging 1.00
R5659:Shc3 UTSW 13 51516594 missense probably damaging 1.00
R6035:Shc3 UTSW 13 51461432 missense probably damaging 1.00
R6035:Shc3 UTSW 13 51461432 missense probably damaging 1.00
R6346:Shc3 UTSW 13 51451615 missense possibly damaging 0.93
R6434:Shc3 UTSW 13 51449290 missense probably damaging 1.00
R6457:Shc3 UTSW 13 51482879 splice site probably null
R6580:Shc3 UTSW 13 51442773 missense probably benign
R6597:Shc3 UTSW 13 51442973 missense possibly damaging 0.92
R6906:Shc3 UTSW 13 51466559 missense probably damaging 0.97
R7003:Shc3 UTSW 13 51466552 missense probably benign 0.14
R7104:Shc3 UTSW 13 51431205 missense possibly damaging 0.89
R7420:Shc3 UTSW 13 51431235 missense probably benign 0.02
R7476:Shc3 UTSW 13 51448006 missense probably benign
Z1177:Shc3 UTSW 13 51442928 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCCTGACTCCATCACCAG -3'
(R):5'- GGATGTTTCCTATAGAGGCAGG -3'

Sequencing Primer
(F):5'- ACCAGCCTCCGGTATTGGAAG -3'
(R):5'- ACTATCCCTAAGATGTGGGTCTCAG -3'
Posted On2016-07-06