Incidental Mutation 'R5262:Hrh4'
ID401530
Institutional Source Beutler Lab
Gene Symbol Hrh4
Ensembl Gene ENSMUSG00000037346
Gene Namehistamine receptor H4
SynonymsH4R
MMRRC Submission 042857-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5262 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location13006990-13022882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 13015813 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 77 (L77F)
Ref Sequence ENSEMBL: ENSMUSP00000041061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041676]
Predicted Effect probably damaging
Transcript: ENSMUST00000041676
AA Change: L77F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041061
Gene: ENSMUSG00000037346
AA Change: L77F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 26 211 1e-5 PFAM
Pfam:7tm_1 32 360 8.1e-58 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by a family of histamine receptors, which are a subset of the G-protein coupled receptor superfamily. This gene encodes a histamine receptor that is predominantly expressed in haematopoietic cells. The protein is thought to play a role in inflammation and allergy reponses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased allergic response to airway inflammation and decreased Th2 responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T A 4: 126,496,764 D821V possibly damaging Het
Ankdd1b C A 13: 96,420,773 R384L probably damaging Het
Ces1e A G 8: 93,223,958 F65S probably damaging Het
Cfap53 A C 18: 74,329,459 S425R probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cyp2d34 A T 15: 82,618,371 V188E probably damaging Het
Defb26 A T 2: 152,507,958 M134K unknown Het
Dnah10 A C 5: 124,785,156 K2158N probably damaging Het
Dnah9 C T 11: 66,112,333 V882M probably benign Het
Dpyd C A 3: 118,797,422 Y186* probably null Het
Elovl1 G A 4: 118,430,927 probably benign Het
Fars2 T A 13: 36,342,018 I329N probably damaging Het
Gstm1 T A 3: 108,016,363 M109L probably benign Het
Gtf2e1 T C 16: 37,535,931 T80A probably damaging Het
Gtf2h2 A G 13: 100,481,848 probably benign Het
Ifi47 A G 11: 49,095,732 T109A probably benign Het
Igsf5 G T 16: 96,391,037 E179* probably null Het
Ints8 A G 4: 11,211,916 I885T probably damaging Het
Iqgap1 T G 7: 80,726,742 I1341L probably benign Het
Kmt2b A G 7: 30,569,794 L2567P probably damaging Het
Lilrb4a T C 10: 51,493,207 probably null Het
Maip1 G A 1: 57,406,972 R67H probably damaging Het
Muc6 T A 7: 141,651,110 I254F possibly damaging Het
Nfkb1 A T 3: 135,612,412 probably null Het
Nlrp4a T C 7: 26,459,811 probably null Het
Nrap A T 19: 56,320,223 I1477N possibly damaging Het
Pdgfa A G 5: 138,993,294 S52P probably benign Het
Pou1f1 G T 16: 65,531,982 E196* probably null Het
Ppp2r5e G A 12: 75,593,271 R19W probably damaging Het
Ptn T A 6: 36,744,484 Q7L probably benign Het
Rbp3 G T 14: 33,954,850 A252S probably damaging Het
Rcor2 G T 19: 7,274,061 V313L probably damaging Het
Rtp3 A T 9: 110,986,127 probably benign Het
Ryr2 T C 13: 11,772,437 T1017A probably damaging Het
Scgb2b11 T C 7: 32,209,351 N108S probably benign Het
Sgo2b C A 8: 63,943,137 L28F probably damaging Het
Shroom3 A G 5: 92,964,573 E1850G probably damaging Het
Slc16a14 A G 1: 84,912,891 L231P probably benign Het
Slfn5 A G 11: 82,956,670 E127G possibly damaging Het
Snx16 C T 3: 10,437,832 M118I probably damaging Het
Snx21 T C 2: 164,791,821 F176L probably damaging Het
Tap2 A G 17: 34,214,016 N424S probably benign Het
Tcf7l1 T C 6: 72,636,466 probably benign Het
Trappc8 C T 18: 20,818,190 V1400I probably benign Het
Trim58 T C 11: 58,651,668 Y485H possibly damaging Het
U2af1l4 C T 7: 30,564,213 T65I probably benign Het
Ufl1 G T 4: 25,251,294 probably benign Het
Usp8 A G 2: 126,751,111 N762S probably damaging Het
Virma A T 4: 11,539,926 D1465V probably benign Het
Vmn1r48 A T 6: 90,036,034 S270T probably benign Het
Vrk2 T A 11: 26,591,697 Y9F possibly damaging Het
Wwp1 A G 4: 19,631,057 F659L probably damaging Het
Zbtb24 C T 10: 41,464,560 Q529* probably null Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Hrh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Hrh4 APN 18 13015947 splice site probably benign
IGL01544:Hrh4 APN 18 13015893 missense probably benign 0.22
IGL01765:Hrh4 APN 18 13007195 missense probably damaging 1.00
IGL02117:Hrh4 APN 18 13022420 missense probably benign 0.02
IGL02559:Hrh4 APN 18 13007244 critical splice donor site probably null
IGL03277:Hrh4 APN 18 13015883 missense probably damaging 1.00
IGL03281:Hrh4 APN 18 13022469 missense possibly damaging 0.94
R0267:Hrh4 UTSW 18 13022398 nonsense probably null
R0329:Hrh4 UTSW 18 13007245 splice site probably benign
R1601:Hrh4 UTSW 18 13015898 missense possibly damaging 0.86
R1827:Hrh4 UTSW 18 13022204 missense probably damaging 0.97
R2964:Hrh4 UTSW 18 13022369 missense probably benign 0.43
R3843:Hrh4 UTSW 18 13022286 missense possibly damaging 0.77
R5325:Hrh4 UTSW 18 13021997 nonsense probably null
R5473:Hrh4 UTSW 18 13021928 missense probably benign 0.34
R6500:Hrh4 UTSW 18 13022468 missense probably damaging 0.98
R6622:Hrh4 UTSW 18 13022397 missense probably damaging 1.00
R7574:Hrh4 UTSW 18 13021913 missense possibly damaging 0.92
R7877:Hrh4 UTSW 18 13022525 missense possibly damaging 0.50
R7960:Hrh4 UTSW 18 13022525 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GACATGCCATTCTATGATGTATCC -3'
(R):5'- CAGTACAGGCTTAAGGACCC -3'

Sequencing Primer
(F):5'- GCTATGCATGTGTAAGTTAGAGCAC -3'
(R):5'- GGACCCAGAATTTACAACTGTAGTC -3'
Posted On2016-07-06