Incidental Mutation 'R3843:Hrh4'
ID277262
Institutional Source Beutler Lab
Gene Symbol Hrh4
Ensembl Gene ENSMUSG00000037346
Gene Namehistamine receptor H4
SynonymsH4R
MMRRC Submission 040783-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3843 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location13006990-13022882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13022286 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 294 (Y294C)
Ref Sequence ENSEMBL: ENSMUSP00000041061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041676]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041676
AA Change: Y294C

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041061
Gene: ENSMUSG00000037346
AA Change: Y294C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 26 211 1e-5 PFAM
Pfam:7tm_1 32 360 8.1e-58 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by a family of histamine receptors, which are a subset of the G-protein coupled receptor superfamily. This gene encodes a histamine receptor that is predominantly expressed in haematopoietic cells. The protein is thought to play a role in inflammation and allergy reponses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased allergic response to airway inflammation and decreased Th2 responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,496 Y168* probably null Het
Amt C T 9: 108,297,221 R62C possibly damaging Het
Arid2 C T 15: 96,351,840 T145I possibly damaging Het
Ccdc8 T C 7: 16,995,114 V176A probably damaging Het
Cdhr1 G T 14: 37,084,927 F440L probably benign Het
Ckap2 A T 8: 22,175,758 N424K probably damaging Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Dennd1b C A 1: 139,053,354 P102Q probably damaging Het
E2f1 A G 2: 154,560,828 S340P probably benign Het
Eef1akmt2 C T 7: 132,831,576 V134I probably damaging Het
Elp3 A T 14: 65,565,483 probably null Het
Grap T G 11: 61,660,325 probably null Het
Heatr1 T C 13: 12,435,121 Y1999H probably benign Het
Hectd4 G T 5: 121,259,873 W288L possibly damaging Het
Hnf4g G A 3: 3,651,302 C262Y probably benign Het
Igkv5-39 C A 6: 69,900,542 G77W probably damaging Het
Kdm2b A T 5: 122,934,793 Y341N probably damaging Het
Kif26b T C 1: 178,928,177 L1952P probably damaging Het
Lgr4 C T 2: 109,996,773 probably benign Het
Nlrc3 G A 16: 3,964,964 R194W probably benign Het
Nup214 T C 2: 32,051,100 F547L probably damaging Het
Olfr1032 A G 2: 86,008,204 I143V probably benign Het
Pdp1 T C 4: 11,961,961 K117E probably benign Het
Phtf2 G A 5: 20,774,022 A31V probably damaging Het
Pkhd1 A T 1: 20,558,723 C667S probably benign Het
Pnp2 T A 14: 50,963,421 L121Q probably null Het
Ppfia1 C T 7: 144,504,970 R698Q probably benign Het
Sidt1 A T 16: 44,284,224 F275I probably benign Het
Slc50a1 A T 3: 89,269,900 I70N probably damaging Het
Sytl2 C G 7: 90,360,159 T123R possibly damaging Het
Tlk1 T A 2: 70,749,327 T214S probably benign Het
Tmco3 A G 8: 13,296,114 probably benign Het
Tmem55a T A 4: 14,886,553 Y42* probably null Het
Trim71 T C 9: 114,515,846 T335A probably benign Het
Zfp651 T A 9: 121,763,433 V273E possibly damaging Het
Other mutations in Hrh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Hrh4 APN 18 13015947 splice site probably benign
IGL01544:Hrh4 APN 18 13015893 missense probably benign 0.22
IGL01765:Hrh4 APN 18 13007195 missense probably damaging 1.00
IGL02117:Hrh4 APN 18 13022420 missense probably benign 0.02
IGL02559:Hrh4 APN 18 13007244 critical splice donor site probably null
IGL03277:Hrh4 APN 18 13015883 missense probably damaging 1.00
IGL03281:Hrh4 APN 18 13022469 missense possibly damaging 0.94
BB009:Hrh4 UTSW 18 13015812 nonsense probably null
BB019:Hrh4 UTSW 18 13015812 nonsense probably null
R0267:Hrh4 UTSW 18 13022398 nonsense probably null
R0329:Hrh4 UTSW 18 13007245 splice site probably benign
R1601:Hrh4 UTSW 18 13015898 missense possibly damaging 0.86
R1827:Hrh4 UTSW 18 13022204 missense probably damaging 0.97
R2964:Hrh4 UTSW 18 13022369 missense probably benign 0.43
R5262:Hrh4 UTSW 18 13015813 missense probably damaging 0.99
R5325:Hrh4 UTSW 18 13021997 nonsense probably null
R5473:Hrh4 UTSW 18 13021928 missense probably benign 0.34
R6500:Hrh4 UTSW 18 13022468 missense probably damaging 0.98
R6622:Hrh4 UTSW 18 13022397 missense probably damaging 1.00
R7574:Hrh4 UTSW 18 13021913 missense possibly damaging 0.92
R7877:Hrh4 UTSW 18 13022525 missense possibly damaging 0.50
R7932:Hrh4 UTSW 18 13015812 nonsense probably null
R8197:Hrh4 UTSW 18 13021929 missense probably damaging 1.00
R8278:Hrh4 UTSW 18 13007227 missense probably damaging 0.99
R8549:Hrh4 UTSW 18 13022058 missense possibly damaging 0.62
R8873:Hrh4 UTSW 18 13007138 missense
Predicted Primers PCR Primer
(F):5'- ACCTCTTCCAGTGCTTCAGG -3'
(R):5'- AACGAATTGAACCATTGCAGC -3'

Sequencing Primer
(F):5'- GTGCTTCAGGACACTTACACAGAG -3'
(R):5'- TTGAACCATTGCAGCCAGAAG -3'
Posted On2015-04-06