Incidental Mutation 'R5282:Fam171b'
ID402805
Institutional Source Beutler Lab
Gene Symbol Fam171b
Ensembl Gene ENSMUSG00000048388
Gene Namefamily with sequence similarity 171, member B
SynonymsD430039N05Rik
MMRRC Submission 042867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5282 (G1)
Quality Score221
Status Not validated
Chromosome2
Chromosomal Location83812636-83883486 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 83853605 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051454]
Predicted Effect probably null
Transcript: ENSMUST00000051454
SMART Domains Protein: ENSMUSP00000062702
Gene: ENSMUSG00000048388

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
Pfam:UPF0560 80 591 4.3e-101 PFAM
Pfam:UPF0560 583 821 6.7e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148184
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,240 M1K probably null Het
2810021J22Rik T C 11: 58,880,340 L216S possibly damaging Het
4933405O20Rik G A 7: 50,599,472 E85K possibly damaging Het
Agrn A G 4: 156,173,035 F1153L probably damaging Het
Cbx8 A G 11: 119,038,916 S284P probably damaging Het
Cep128 A G 12: 91,339,119 L170P probably damaging Het
Cyp4f14 T A 17: 32,907,985 T324S probably damaging Het
Daw1 G T 1: 83,192,698 V244L probably benign Het
Eef2kmt A G 16: 5,245,358 V306A probably benign Het
Enah A T 1: 181,935,728 probably null Het
Fsip2 C T 2: 82,978,581 T1748I possibly damaging Het
Gabrg2 C T 11: 41,971,732 G175D probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hmcn1 G T 1: 150,582,296 N33K probably damaging Het
Incenp T A 19: 9,878,406 E514V unknown Het
Kank3 T C 17: 33,817,943 S74P probably benign Het
Lrriq1 G T 10: 103,215,345 N515K probably benign Het
Mfsd13b G A 7: 120,991,833 D266N probably damaging Het
Neto1 T C 18: 86,404,873 Y152H probably damaging Het
Nub1 C A 5: 24,695,535 F145L probably benign Het
Nufip1 T C 14: 76,114,275 probably null Het
Pard6g T A 18: 80,079,901 V50E probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Rapgef5 A C 12: 117,739,644 N431T probably damaging Het
Rassf9 A T 10: 102,545,344 T196S probably damaging Het
Rrp12 T C 19: 41,876,590 Y764C probably benign Het
Slfn8 T C 11: 83,017,724 probably null Het
Smox T A 2: 131,521,106 V265D probably damaging Het
Sult1b1 T C 5: 87,530,651 I105V probably benign Het
Sycp2 T C 2: 178,403,761 D22G probably damaging Het
Tbck G A 3: 132,751,216 M630I possibly damaging Het
Tenm4 G C 7: 96,837,331 G965R possibly damaging Het
Trappc10 G A 10: 78,187,860 T1258I probably damaging Het
Tssk1 G A 16: 17,895,259 G303S probably benign Het
Tstd2 T C 4: 46,120,461 Y313C probably damaging Het
Usp42 G A 5: 143,721,646 T260M probably damaging Het
Wdr43 T A 17: 71,648,777 V479E probably damaging Het
Xpo7 G A 14: 70,683,731 T599I probably damaging Het
Zfp553 A G 7: 127,236,841 K523E probably benign Het
Other mutations in Fam171b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Fam171b APN 2 83876728 nonsense probably null
IGL01309:Fam171b APN 2 83879447 nonsense probably null
IGL01515:Fam171b APN 2 83880233 missense probably damaging 0.99
IGL01604:Fam171b APN 2 83879600 missense possibly damaging 0.50
IGL01729:Fam171b APN 2 83855537 splice site probably benign
IGL01784:Fam171b APN 2 83879687 missense possibly damaging 0.83
P0028:Fam171b UTSW 2 83853439 missense probably damaging 1.00
R1203:Fam171b UTSW 2 83812969 missense probably benign 0.05
R1530:Fam171b UTSW 2 83880189 missense probably damaging 1.00
R1539:Fam171b UTSW 2 83880098 missense probably benign 0.00
R1564:Fam171b UTSW 2 83880284 missense probably damaging 1.00
R1858:Fam171b UTSW 2 83853381 missense probably benign
R1940:Fam171b UTSW 2 83812874 small deletion probably benign
R2131:Fam171b UTSW 2 83879858 missense probably damaging 0.97
R3746:Fam171b UTSW 2 83879600 missense probably damaging 1.00
R3777:Fam171b UTSW 2 83878261 missense probably benign 0.03
R3840:Fam171b UTSW 2 83880062 missense possibly damaging 0.76
R4920:Fam171b UTSW 2 83880359 missense possibly damaging 0.73
R5007:Fam171b UTSW 2 83855509 nonsense probably null
R5178:Fam171b UTSW 2 83879987 missense probably damaging 1.00
R5544:Fam171b UTSW 2 83855527 missense possibly damaging 0.58
R5614:Fam171b UTSW 2 83812873 missense probably damaging 0.99
R5786:Fam171b UTSW 2 83878236 missense probably benign 0.38
R6190:Fam171b UTSW 2 83876698 missense probably benign
R6247:Fam171b UTSW 2 83879208 missense probably damaging 1.00
R6309:Fam171b UTSW 2 83860460 missense probably damaging 0.99
R6324:Fam171b UTSW 2 83879264 nonsense probably null
R7127:Fam171b UTSW 2 83879766 missense probably benign 0.25
R7201:Fam171b UTSW 2 83878230 missense probably damaging 1.00
R7223:Fam171b UTSW 2 83878230 missense probably damaging 1.00
R7689:Fam171b UTSW 2 83879388 missense probably benign 0.38
R7904:Fam171b UTSW 2 83853505 missense probably damaging 0.97
R8069:Fam171b UTSW 2 83812874 small deletion probably benign
R8236:Fam171b UTSW 2 83880206 missense probably damaging 0.97
R8252:Fam171b UTSW 2 83878242 missense probably benign 0.00
R8458:Fam171b UTSW 2 83860520 missense probably benign 0.21
RF001:Fam171b UTSW 2 83812886 small insertion probably benign
RF009:Fam171b UTSW 2 83812880 small insertion probably benign
RF011:Fam171b UTSW 2 83812873 small insertion probably benign
RF011:Fam171b UTSW 2 83812895 small insertion probably benign
RF013:Fam171b UTSW 2 83812895 small insertion probably benign
RF027:Fam171b UTSW 2 83812876 small insertion probably benign
RF029:Fam171b UTSW 2 83812892 small insertion probably benign
RF036:Fam171b UTSW 2 83812892 small insertion probably benign
RF055:Fam171b UTSW 2 83812876 small insertion probably benign
RF056:Fam171b UTSW 2 83812896 small insertion probably benign
RF060:Fam171b UTSW 2 83812877 small insertion probably benign
RF063:Fam171b UTSW 2 83812896 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATGACATCGTCAGTCGCCAG -3'
(R):5'- TGTGTCAACCTGAATTTCACCAC -3'

Sequencing Primer
(F):5'- ATCGTCAGTCGCCAGTACCTG -3'
(R):5'- CTCCAGAACTGTATGGAATCGCTG -3'
Posted On2016-07-22