Incidental Mutation 'RF029:Fam171b'
ID604259
Institutional Source Beutler Lab
Gene Symbol Fam171b
Ensembl Gene ENSMUSG00000048388
Gene Namefamily with sequence similarity 171, member B
SynonymsD430039N05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #RF029 (G1)
Quality Score214.472
Status Not validated
Chromosome2
Chromosomal Location83812636-83883486 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GCAGC to GCAGCATCAGC at 83812892 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051454]
Predicted Effect probably benign
Transcript: ENSMUST00000051454
SMART Domains Protein: ENSMUSP00000062702
Gene: ENSMUSG00000048388

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
Pfam:UPF0560 80 591 4.3e-101 PFAM
Pfam:UPF0560 583 821 6.7e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik GGTGGCCAG GGTGGCCAGCAAAAACAGAAAGGAAAAAGTGGCCAG 6: 131,552,895 probably benign Het
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
C1s1 CCCATGGCTC CC 6: 124,541,351 probably null Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Dnmt1 CGGAGCACAGTTCCTACCTCGTT CGGAGCACAGTTCCTACCTCGTTTTGGGGGAGGAGCACAGTTCCTACCTCGTT 9: 20,910,123 probably null Het
Eed C A 7: 89,955,032 A411S probably benign Het
Exd2 CCACAGC CC 12: 80,475,946 probably null Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,378,139 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,169,442 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Krtap28-10 CACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCAC 1: 83,042,270 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCTGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Nusap1 CTGAGA CTGAGATACACGTTAGCAGTGAGGAGCAAGATGAGA 2: 119,627,605 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Rbm12 TATTGCGGGACCAGGTATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC 2: 156,096,095 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Tcof1 CAG CAGAAG 18: 60,835,735 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in Fam171b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Fam171b APN 2 83876728 nonsense probably null
IGL01309:Fam171b APN 2 83879447 nonsense probably null
IGL01515:Fam171b APN 2 83880233 missense probably damaging 0.99
IGL01604:Fam171b APN 2 83879600 missense possibly damaging 0.50
IGL01729:Fam171b APN 2 83855537 splice site probably benign
IGL01784:Fam171b APN 2 83879687 missense possibly damaging 0.83
P0028:Fam171b UTSW 2 83853439 missense probably damaging 1.00
R1203:Fam171b UTSW 2 83812969 missense probably benign 0.05
R1530:Fam171b UTSW 2 83880189 missense probably damaging 1.00
R1539:Fam171b UTSW 2 83880098 missense probably benign 0.00
R1564:Fam171b UTSW 2 83880284 missense probably damaging 1.00
R1858:Fam171b UTSW 2 83853381 missense probably benign
R1940:Fam171b UTSW 2 83812874 small deletion probably benign
R2131:Fam171b UTSW 2 83879858 missense probably damaging 0.97
R3746:Fam171b UTSW 2 83879600 missense probably damaging 1.00
R3777:Fam171b UTSW 2 83878261 missense probably benign 0.03
R3840:Fam171b UTSW 2 83880062 missense possibly damaging 0.76
R4920:Fam171b UTSW 2 83880359 missense possibly damaging 0.73
R5007:Fam171b UTSW 2 83855509 nonsense probably null
R5178:Fam171b UTSW 2 83879987 missense probably damaging 1.00
R5282:Fam171b UTSW 2 83853605 critical splice donor site probably null
R5544:Fam171b UTSW 2 83855527 missense possibly damaging 0.58
R5614:Fam171b UTSW 2 83812873 missense probably damaging 0.99
R5786:Fam171b UTSW 2 83878236 missense probably benign 0.38
R6190:Fam171b UTSW 2 83876698 missense probably benign
R6247:Fam171b UTSW 2 83879208 missense probably damaging 1.00
R6309:Fam171b UTSW 2 83860460 missense probably damaging 0.99
R6324:Fam171b UTSW 2 83879264 nonsense probably null
R7127:Fam171b UTSW 2 83879766 missense probably benign 0.25
R7201:Fam171b UTSW 2 83878230 missense probably damaging 1.00
R7223:Fam171b UTSW 2 83878230 missense probably damaging 1.00
R7689:Fam171b UTSW 2 83879388 missense probably benign 0.38
R7904:Fam171b UTSW 2 83853505 missense probably damaging 0.97
R8069:Fam171b UTSW 2 83812874 small deletion probably benign
R8236:Fam171b UTSW 2 83880206 missense probably damaging 0.97
R8252:Fam171b UTSW 2 83878242 missense probably benign 0.00
R8458:Fam171b UTSW 2 83860520 missense probably benign 0.21
RF001:Fam171b UTSW 2 83812886 small insertion probably benign
RF009:Fam171b UTSW 2 83812880 small insertion probably benign
RF011:Fam171b UTSW 2 83812873 small insertion probably benign
RF011:Fam171b UTSW 2 83812895 small insertion probably benign
RF013:Fam171b UTSW 2 83812895 small insertion probably benign
RF027:Fam171b UTSW 2 83812876 small insertion probably benign
RF036:Fam171b UTSW 2 83812892 small insertion probably benign
RF055:Fam171b UTSW 2 83812876 small insertion probably benign
RF056:Fam171b UTSW 2 83812896 small insertion probably benign
RF060:Fam171b UTSW 2 83812877 small insertion probably benign
RF063:Fam171b UTSW 2 83812896 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCACCTTGCAGAGCACTTGC -3'
(R):5'- TTTCCCACCCGAGCAAAGAG -3'

Sequencing Primer
(F):5'- TCACGTGCGCGAGGATG -3'
(R):5'- GCAACCTGGGAAGACGC -3'
Posted On2019-12-04