Incidental Mutation 'R5211:Nyap2'
ID403116
Institutional Source Beutler Lab
Gene Symbol Nyap2
Ensembl Gene ENSMUSG00000054976
Gene Nameneuronal tyrosine-phophorylated phosphoinositide 3-kinase adaptor 2
SynonymsJr6, 9430031J16Rik
MMRRC Submission 042785-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5211 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location81076950-81341764 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 81087274 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000122935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068275] [ENSMUST00000113494] [ENSMUST00000123285] [ENSMUST00000123720] [ENSMUST00000137862]
Predicted Effect probably null
Transcript: ENSMUST00000068275
AA Change: M1K

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065468
Gene: ENSMUSG00000054976
AA Change: M1K

DomainStartEndE-ValueType
Pfam:NYAP_N 44 447 1.5e-139 PFAM
Pfam:NYAP_C 496 709 5.2e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113494
AA Change: M1K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109122
Gene: ENSMUSG00000054976
AA Change: M1K

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.4e-134 PFAM
Pfam:NYAP_C 420 647 7.7e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123285
AA Change: M1K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122935
Gene: ENSMUSG00000054976
AA Change: M1K

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.9e-134 PFAM
Pfam:NYAP_C 420 716 6.3e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123720
AA Change: M1K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000117661
Gene: ENSMUSG00000054976
AA Change: M1K

DomainStartEndE-ValueType
Pfam:NYAP_N 43 448 1.9e-127 PFAM
low complexity region 489 510 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
low complexity region 649 662 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137862
AA Change: M1K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000120767
Gene: ENSMUSG00000054976
AA Change: M1K

DomainStartEndE-ValueType
Pfam:NYAP_N 43 416 1.4e-134 PFAM
Pfam:NYAP_C 420 647 7.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A G 14: 70,156,784 S181P probably benign Het
Adgrf5 A T 17: 43,422,620 T112S probably benign Het
Ascc2 T C 11: 4,673,399 V545A possibly damaging Het
Bmp2 A T 2: 133,554,630 S69C probably damaging Het
Btaf1 T A 19: 36,996,562 I1378K probably benign Het
Ces2b C T 8: 104,835,063 T263I possibly damaging Het
Cntn5 A T 9: 9,704,889 V635D possibly damaging Het
Dock6 T C 9: 21,820,352 E1218G probably benign Het
Eml6 T C 11: 29,854,145 I319V probably benign Het
Esd T C 14: 74,741,192 S65P probably damaging Het
Fam71f2 A T 6: 29,286,099 K128* probably null Het
Fstl3 A T 10: 79,780,178 Q166L probably benign Het
Gcn1l1 T A 5: 115,619,312 S2445T probably benign Het
Gfy C A 7: 45,177,858 L271F possibly damaging Het
Gjc2 A G 11: 59,177,458 V66A possibly damaging Het
Gm7271 C A 5: 76,516,403 T113K possibly damaging Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Itm2c T A 1: 85,906,528 V188E probably damaging Het
Jmjd1c C G 10: 67,232,016 S1766C probably damaging Het
Kcnn3 A G 3: 89,521,231 T255A probably benign Het
Kdm4d A C 9: 14,463,104 V486G probably benign Het
Krt18 T G 15: 102,031,453 I362S probably damaging Het
Lrrc8d G A 5: 105,813,740 R672Q probably damaging Het
Ly6f G A 15: 75,271,803 V120M probably damaging Het
Map3k4 A G 17: 12,232,434 V1524A possibly damaging Het
Mrgprh T C 17: 12,877,002 V43A probably benign Het
Mx2 A T 16: 97,547,433 M269L probably damaging Het
Myrfl C T 10: 116,798,630 V620I probably benign Het
Nlrp9b G A 7: 20,049,456 C908Y probably damaging Het
Olfml3 A T 3: 103,737,199 H51Q probably benign Het
Olfr745 C T 14: 50,643,253 T324I possibly damaging Het
Pcdhb1 G A 18: 37,266,651 V552I probably benign Het
Pm20d1 T A 1: 131,806,909 I353N possibly damaging Het
Sbk2 A G 7: 4,962,967 F73L possibly damaging Het
Scn10a A C 9: 119,661,232 L548R possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slmap T C 14: 26,482,962 Y68C probably damaging Het
Syde2 T C 3: 146,001,338 V611A probably benign Het
Sympk A G 7: 19,035,889 M164V probably benign Het
Syt17 T C 7: 118,442,403 S43G probably benign Het
Ubr1 T C 2: 120,893,170 T1303A possibly damaging Het
Vmn2r100 A G 17: 19,525,995 Y535C possibly damaging Het
Other mutations in Nyap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Nyap2 APN 1 81191980 missense probably damaging 0.99
IGL01660:Nyap2 APN 1 81191927 missense probably damaging 0.99
IGL02379:Nyap2 APN 1 81087430 missense probably damaging 1.00
IGL02652:Nyap2 APN 1 81241720 missense probably damaging 1.00
IGL03217:Nyap2 APN 1 81087322 missense probably damaging 1.00
IGL03410:Nyap2 APN 1 81241441 missense possibly damaging 0.95
R0001:Nyap2 UTSW 1 81192107 missense probably benign 0.03
R0014:Nyap2 UTSW 1 81241951 missense probably damaging 0.99
R0506:Nyap2 UTSW 1 81087312 missense probably damaging 0.99
R1512:Nyap2 UTSW 1 81241851 missense probably damaging 0.98
R1914:Nyap2 UTSW 1 81191887 missense probably damaging 1.00
R2018:Nyap2 UTSW 1 81191872 missense probably benign 0.03
R2078:Nyap2 UTSW 1 81191981 missense probably damaging 1.00
R2139:Nyap2 UTSW 1 81241268 missense probably damaging 1.00
R2915:Nyap2 UTSW 1 81087471 nonsense probably null
R2972:Nyap2 UTSW 1 81191770 nonsense probably null
R2974:Nyap2 UTSW 1 81191770 nonsense probably null
R3076:Nyap2 UTSW 1 81241971 critical splice donor site probably null
R4066:Nyap2 UTSW 1 81241835 missense probably damaging 1.00
R4134:Nyap2 UTSW 1 81241193 missense probably damaging 0.99
R4298:Nyap2 UTSW 1 81241096 missense probably damaging 1.00
R4652:Nyap2 UTSW 1 81336729 missense probably damaging 0.98
R4788:Nyap2 UTSW 1 81269397 missense probably benign
R4816:Nyap2 UTSW 1 81241313 missense probably damaging 1.00
R5327:Nyap2 UTSW 1 81192041 missense possibly damaging 0.77
R5453:Nyap2 UTSW 1 81192142 missense probably benign 0.01
R7337:Nyap2 UTSW 1 81336515 missense possibly damaging 0.50
R7558:Nyap2 UTSW 1 81269373 missense probably benign 0.01
R8078:Nyap2 UTSW 1 81241057 missense possibly damaging 0.95
R8231:Nyap2 UTSW 1 81192131 missense probably benign
X0067:Nyap2 UTSW 1 81269319 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTGTAGGACTATATGGAGATGACC -3'
(R):5'- CTCCTTCAAGTAAGCCAGGTTTGTC -3'

Sequencing Primer
(F):5'- CCACCTGATGAATTCTGGGAC -3'
(R):5'- CAAGTAAGCCAGGTTTGTCTCATTTC -3'
Posted On2016-07-22