Incidental Mutation 'R5211:Lrrc8d'
ID403126
Institutional Source Beutler Lab
Gene Symbol Lrrc8d
Ensembl Gene ENSMUSG00000046079
Gene Nameleucine rich repeat containing 8D
SynonymsLrrc5, 2810473G09Rik, 4930525N13Rik
MMRRC Submission 042785-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5211 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location105699969-105832436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105813740 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 672 (R672Q)
Ref Sequence ENSEMBL: ENSMUSP00000113603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060531] [ENSMUST00000120847] [ENSMUST00000127686] [ENSMUST00000154807] [ENSMUST00000156630]
Predicted Effect probably damaging
Transcript: ENSMUST00000060531
AA Change: R672Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057293
Gene: ENSMUSG00000046079
AA Change: R672Q

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 5.6e-31 PFAM
Pfam:DUF3733 138 197 2e-24 PFAM
transmembrane domain 366 388 N/A INTRINSIC
internal_repeat_1 490 607 1.13e-8 PROSPERO
LRR 658 681 1.23e0 SMART
LRR 683 705 2.03e1 SMART
LRR_TYP 706 729 9.58e-3 SMART
LRR 730 751 2.47e2 SMART
LRR 752 775 1.76e-1 SMART
LRR 776 797 1.01e2 SMART
LRR 798 821 3.29e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120847
AA Change: R672Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113603
Gene: ENSMUSG00000046079
AA Change: R672Q

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 385 2.2e-160 PFAM
internal_repeat_1 490 607 1.13e-8 PROSPERO
LRR 658 681 1.23e0 SMART
LRR 683 705 2.03e1 SMART
LRR_TYP 706 729 9.58e-3 SMART
LRR 730 751 2.47e2 SMART
LRR 752 775 1.76e-1 SMART
LRR 776 797 1.01e2 SMART
LRR 798 821 3.29e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149831
Predicted Effect probably benign
Transcript: ENSMUST00000154807
SMART Domains Protein: ENSMUSP00000114662
Gene: ENSMUSG00000046079

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156630
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A G 14: 70,156,784 S181P probably benign Het
Adgrf5 A T 17: 43,422,620 T112S probably benign Het
Ascc2 T C 11: 4,673,399 V545A possibly damaging Het
Bmp2 A T 2: 133,554,630 S69C probably damaging Het
Btaf1 T A 19: 36,996,562 I1378K probably benign Het
Ces2b C T 8: 104,835,063 T263I possibly damaging Het
Cntn5 A T 9: 9,704,889 V635D possibly damaging Het
Dock6 T C 9: 21,820,352 E1218G probably benign Het
Eml6 T C 11: 29,854,145 I319V probably benign Het
Esd T C 14: 74,741,192 S65P probably damaging Het
Fam71f2 A T 6: 29,286,099 K128* probably null Het
Fstl3 A T 10: 79,780,178 Q166L probably benign Het
Gcn1l1 T A 5: 115,619,312 S2445T probably benign Het
Gfy C A 7: 45,177,858 L271F possibly damaging Het
Gjc2 A G 11: 59,177,458 V66A possibly damaging Het
Gm7271 C A 5: 76,516,403 T113K possibly damaging Het
Hist1h3d G T 13: 23,575,841 G14C possibly damaging Het
Itm2c T A 1: 85,906,528 V188E probably damaging Het
Jmjd1c C G 10: 67,232,016 S1766C probably damaging Het
Kcnn3 A G 3: 89,521,231 T255A probably benign Het
Kdm4d A C 9: 14,463,104 V486G probably benign Het
Krt18 T G 15: 102,031,453 I362S probably damaging Het
Ly6f G A 15: 75,271,803 V120M probably damaging Het
Map3k4 A G 17: 12,232,434 V1524A possibly damaging Het
Mrgprh T C 17: 12,877,002 V43A probably benign Het
Mx2 A T 16: 97,547,433 M269L probably damaging Het
Myrfl C T 10: 116,798,630 V620I probably benign Het
Nlrp9b G A 7: 20,049,456 C908Y probably damaging Het
Nyap2 T A 1: 81,087,274 M1K probably null Het
Olfml3 A T 3: 103,737,199 H51Q probably benign Het
Olfr745 C T 14: 50,643,253 T324I possibly damaging Het
Pcdhb1 G A 18: 37,266,651 V552I probably benign Het
Pm20d1 T A 1: 131,806,909 I353N possibly damaging Het
Sbk2 A G 7: 4,962,967 F73L possibly damaging Het
Scn10a A C 9: 119,661,232 L548R possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slmap T C 14: 26,482,962 Y68C probably damaging Het
Syde2 T C 3: 146,001,338 V611A probably benign Het
Sympk A G 7: 19,035,889 M164V probably benign Het
Syt17 T C 7: 118,442,403 S43G probably benign Het
Ubr1 T C 2: 120,893,170 T1303A possibly damaging Het
Vmn2r100 A G 17: 19,525,995 Y535C possibly damaging Het
Other mutations in Lrrc8d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Lrrc8d APN 5 105811952 missense possibly damaging 0.60
IGL01327:Lrrc8d APN 5 105812265 missense probably damaging 1.00
IGL02148:Lrrc8d APN 5 105812387 missense possibly damaging 0.92
IGL02228:Lrrc8d APN 5 105811864 missense probably benign 0.44
IGL02551:Lrrc8d APN 5 105813548 missense possibly damaging 0.78
IGL02605:Lrrc8d APN 5 105826817 intron noncoding transcript
R0415:Lrrc8d UTSW 5 105811865 missense probably damaging 1.00
R1424:Lrrc8d UTSW 5 105826916 missense unknown
R1754:Lrrc8d UTSW 5 105812657 missense probably benign
R3411:Lrrc8d UTSW 5 105826706 intron noncoding transcript
R3605:Lrrc8d UTSW 5 105827007 missense unknown
R3705:Lrrc8d UTSW 5 105813475 missense probably damaging 1.00
R3798:Lrrc8d UTSW 5 105812489 missense probably benign 0.12
R3951:Lrrc8d UTSW 5 105814276 missense probably benign 0.00
R4300:Lrrc8d UTSW 5 105813740 missense probably damaging 0.99
R4953:Lrrc8d UTSW 5 105813368 missense probably damaging 1.00
R5436:Lrrc8d UTSW 5 105812552 missense probably damaging 0.98
R5512:Lrrc8d UTSW 5 105812784 missense probably damaging 1.00
R5512:Lrrc8d UTSW 5 105812785 missense probably benign 0.00
R5514:Lrrc8d UTSW 5 105812784 missense probably damaging 1.00
R5514:Lrrc8d UTSW 5 105812785 missense probably benign 0.00
R5531:Lrrc8d UTSW 5 105797670 intron probably benign
R5929:Lrrc8d UTSW 5 105812606 missense probably damaging 0.98
R6063:Lrrc8d UTSW 5 105812126 missense probably benign 0.01
R6379:Lrrc8d UTSW 5 105812809 missense probably benign 0.08
R6431:Lrrc8d UTSW 5 105811760 missense probably damaging 1.00
R7127:Lrrc8d UTSW 5 105812963 missense probably damaging 1.00
R7682:Lrrc8d UTSW 5 105812791 missense probably damaging 1.00
R7821:Lrrc8d UTSW 5 105812344 missense probably damaging 1.00
RF003:Lrrc8d UTSW 5 105812641 missense probably damaging 1.00
X0024:Lrrc8d UTSW 5 105811745 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTAACATCACCGACGTGGC -3'
(R):5'- TAGCTGACGTCTAAGCATCTG -3'

Sequencing Primer
(F):5'- GCTCCGCACCTCACGAAG -3'
(R):5'- GCTGACGTCTAAGCATCTGAGTTTC -3'
Posted On2016-07-22