Incidental Mutation 'R0482:Ddi1'
ID42046
Institutional Source Beutler Lab
Gene Symbol Ddi1
Ensembl Gene ENSMUSG00000047619
Gene NameDNA-damage inducible 1
Synonyms
MMRRC Submission 038682-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R0482 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location6262733-6269846 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6266144 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 75 (L75P)
Ref Sequence ENSEMBL: ENSMUSP00000053223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051706] [ENSMUST00000058692] [ENSMUST00000168039] [ENSMUST00000214892]
PDB Structure
Solution Structure of the Ubiquitin-like Domain from Mouse Hypothetical 1700011N24Rik Protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000051706
AA Change: L75P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053223
Gene: ENSMUSG00000047619
AA Change: L75P

DomainStartEndE-ValueType
UBQ 3 77 4.57e-1 SMART
low complexity region 111 123 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
Pfam:Asp_protease 226 349 3.3e-63 PFAM
Pfam:RVP_2 229 362 3.6e-8 PFAM
Pfam:RVP 250 349 2.5e-8 PFAM
Pfam:Asp_protease_2 252 340 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058692
SMART Domains Protein: ENSMUSP00000056240
Gene: ENSMUSG00000032006

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CUB 48 164 5.38e-25 SMART
PDGF 265 358 4.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168039
SMART Domains Protein: ENSMUSP00000128388
Gene: ENSMUSG00000032006

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CUB 54 170 5.38e-25 SMART
PDGF 271 364 4.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214892
Meta Mutation Damage Score 0.6515 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,988,423 probably null Het
Abca13 G A 11: 9,328,207 G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 I6M probably benign Het
Adcy4 T A 14: 55,774,572 probably null Het
Agrn A G 4: 156,173,555 S1117P probably damaging Het
Anks1b A G 10: 90,359,195 N545S probably benign Het
Antxr1 C T 6: 87,269,238 probably null Het
Arhgef17 T C 7: 100,880,621 K476E probably damaging Het
Bptf T C 11: 107,081,262 S927G probably benign Het
Cacna1s C T 1: 136,113,394 T1286I probably benign Het
Ccdc174 T A 6: 91,895,266 M292K probably benign Het
Cdk5rap2 G A 4: 70,410,269 probably benign Het
Celsr3 T A 9: 108,829,073 Y918* probably null Het
Cep250 T C 2: 155,964,974 probably benign Het
Ces2h A G 8: 105,020,271 D513G possibly damaging Het
Clec2l A G 6: 38,663,392 T53A probably benign Het
Cntnap2 C T 6: 45,715,816 S77L probably benign Het
Cped1 A T 6: 22,016,958 H102L probably benign Het
Crim1 T A 17: 78,372,579 D916E probably benign Het
Csmd1 T A 8: 16,233,101 I614F probably damaging Het
Csnk1g1 G A 9: 66,010,469 E37K probably damaging Het
Ctnnbl1 T A 2: 157,871,190 probably null Het
Cuzd1 A T 7: 131,309,872 probably benign Het
Cyp4f16 T A 17: 32,550,551 V433D probably damaging Het
Ddias G A 7: 92,859,528 A393V probably benign Het
Dgka A T 10: 128,734,121 Y123* probably null Het
Dlgap1 T C 17: 70,516,190 C57R probably benign Het
Dysf T A 6: 84,152,405 V1458D probably benign Het
Eif2ak4 T A 2: 118,462,347 Y1230N probably damaging Het
Fam160a2 G A 7: 105,384,212 P599L possibly damaging Het
Fam46a T C 9: 85,325,055 Y230C probably damaging Het
Fbxl7 A T 15: 26,543,546 S338R probably benign Het
Fgf23 A T 6: 127,073,159 T44S probably damaging Het
Folh1 A T 7: 86,746,101 probably benign Het
Gpsm2 A T 3: 108,702,394 probably benign Het
Hdac2 T A 10: 36,989,134 probably benign Het
Hist1h2bl A G 13: 21,716,125 probably benign Het
Il31ra G T 13: 112,527,481 T446N possibly damaging Het
Irf5 T A 6: 29,535,370 L199H probably benign Het
Kif18a T A 2: 109,287,843 M1K probably null Het
Kif4-ps A C 12: 101,148,662 I1017L probably benign Het
Klhl2 C T 8: 64,758,130 V295M probably benign Het
Krt75 A T 15: 101,570,311 M296K probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lgr4 T C 2: 110,008,092 S439P probably damaging Het
Lhfpl2 C A 13: 94,174,610 N129K probably damaging Het
Lnx2 A G 5: 147,018,961 V675A probably damaging Het
Med13 T C 11: 86,285,151 T1673A probably benign Het
Mif A G 10: 75,860,140 V10A possibly damaging Het
Mki67 A T 7: 135,699,429 I1292N possibly damaging Het
Mylip C A 13: 45,404,583 N89K probably benign Het
Myo19 G T 11: 84,909,419 D877Y probably benign Het
Nckap5 A G 1: 126,026,365 S753P possibly damaging Het
Nlrc3 T C 16: 3,965,192 T118A possibly damaging Het
Nptx2 T C 5: 144,553,459 Y233H probably damaging Het
Nsl1 T A 1: 191,063,040 M1K probably null Het
Ntsr1 T A 2: 180,501,056 S213R possibly damaging Het
Olfr1225 A T 2: 89,170,631 F194I probably benign Het
Olfr48 A G 2: 89,844,169 V268A probably benign Het
Olfr669 T A 7: 104,938,814 F96Y possibly damaging Het
Pde4d G A 13: 109,936,710 V347I probably benign Het
Pik3r4 T A 9: 105,669,045 S865T probably benign Het
Ppp2r2d A G 7: 138,870,431 R136G probably benign Het
Proser2 A C 2: 6,113,910 S41A probably damaging Het
Proz A T 8: 13,073,460 K244* probably null Het
Prpf38b A T 3: 108,905,270 L209H probably damaging Het
R3hdm1 C A 1: 128,184,517 A390E probably benign Het
Rb1cc1 A C 1: 6,240,323 D315A probably damaging Het
Rnf141 G A 7: 110,837,138 R28* probably null Het
Rps6kc1 A T 1: 190,799,430 S792T probably benign Het
Rxrg A G 1: 167,631,037 D233G possibly damaging Het
Sh2d7 A G 9: 54,541,037 N114S probably benign Het
Slc25a38 T C 9: 120,120,833 V205A probably benign Het
Slc4a10 T C 2: 62,297,017 probably benign Het
Spred1 T A 2: 117,152,978 probably null Het
Stt3b A G 9: 115,248,567 S706P probably benign Het
Tcerg1 C A 18: 42,564,240 probably benign Het
Thsd4 A T 9: 60,002,978 I109N probably damaging Het
Ticrr C A 7: 79,694,488 P1367Q probably damaging Het
Trpv1 A G 11: 73,239,429 D146G probably damaging Het
Tubd1 T G 11: 86,557,776 V305G possibly damaging Het
Tubgcp4 T C 2: 121,175,374 L81P probably benign Het
Ubxn2b T A 4: 6,196,404 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vcan T A 13: 89,678,145 D2220V probably damaging Het
Vmn1r173 T A 7: 23,702,791 N150K probably damaging Het
Vmn1r70 G A 7: 10,634,277 A231T probably damaging Het
Vmn2r97 A G 17: 18,947,668 D728G probably damaging Het
Zbtb40 T C 4: 136,983,228 E1200G probably damaging Het
Zfp365 A T 10: 67,897,606 V252D probably damaging Het
Other mutations in Ddi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Ddi1 APN 9 6265773 missense probably damaging 0.97
IGL01977:Ddi1 APN 9 6266226 missense probably benign 0.01
IGL02260:Ddi1 APN 9 6265760 missense probably benign
IGL02543:Ddi1 APN 9 6266183 missense possibly damaging 0.79
IGL02678:Ddi1 APN 9 6266106 missense probably benign
R1313:Ddi1 UTSW 9 6265769 missense probably damaging 0.99
R1313:Ddi1 UTSW 9 6265769 missense probably damaging 0.99
R1588:Ddi1 UTSW 9 6265391 missense probably damaging 0.98
R1605:Ddi1 UTSW 9 6266012 missense probably benign 0.02
R1671:Ddi1 UTSW 9 6266225 missense possibly damaging 0.81
R4237:Ddi1 UTSW 9 6265799 missense probably benign 0.00
R4239:Ddi1 UTSW 9 6265799 missense probably benign 0.00
R4240:Ddi1 UTSW 9 6265799 missense probably benign 0.00
R4588:Ddi1 UTSW 9 6266003 missense probably benign 0.15
R4790:Ddi1 UTSW 9 6265761 missense probably benign 0.00
R4950:Ddi1 UTSW 9 6266073 missense probably benign 0.04
R5626:Ddi1 UTSW 9 6266003 missense probably benign
R7413:Ddi1 UTSW 9 6265670 missense probably damaging 1.00
R8052:Ddi1 UTSW 9 6265787 missense probably benign
R8260:Ddi1 UTSW 9 6265524 missense probably damaging 1.00
R8285:Ddi1 UTSW 9 6265808 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGGATTCCGTTCCTTCAACAG -3'
(R):5'- GGTAACCTTTTCCCTCCAGGTCAAC -3'

Sequencing Primer
(F):5'- AAGGTCATATTCTCTCCAGAGGC -3'
(R):5'- AGGTCAACCCTGACTTTGAG -3'
Posted On2013-05-23