Incidental Mutation 'R0482:Folh1'
ID42033
Institutional Source Beutler Lab
Gene Symbol Folh1
Ensembl Gene ENSMUSG00000001773
Gene Namefolate hydrolase 1
Synonymsprostate-specific membrane antigen, glutamate carboxypeptidase II, mopsm, GCP2
MMRRC Submission 038682-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0482 (G1)
Quality Score140
Status Validated
Chromosome7
Chromosomal Location86718977-86775943 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 86746101 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001824] [ENSMUST00000107271]
Predicted Effect probably benign
Transcript: ENSMUST00000001824
SMART Domains Protein: ENSMUSP00000001824
Gene: ENSMUSG00000001773

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PA 171 264 2.5e-16 PFAM
Pfam:Peptidase_M28 359 561 1.2e-18 PFAM
Pfam:TFR_dimer 629 749 1.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107271
SMART Domains Protein: ENSMUSP00000102892
Gene: ENSMUSG00000001773

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PA 167 265 7e-18 PFAM
Pfam:Peptidase_M28 339 475 2.1e-15 PFAM
Pfam:TFR_dimer 595 718 1.1e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209082
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 95% (94/99)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in protection from peripheral neuropathy and ischemic brain injury. Homozygotes for a null allele show increased food intake, anxiety-like behavior, smaller sciatic nerve axons, and impaired angiogenesis. Homozygotes for a different null allele show less neuron degeneration and astrocyte damage after traumatic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,988,423 probably null Het
Abca13 G A 11: 9,328,207 G3129D possibly damaging Het
Acnat2 T C 4: 49,383,534 I6M probably benign Het
Adcy4 T A 14: 55,774,572 probably null Het
Agrn A G 4: 156,173,555 S1117P probably damaging Het
Anks1b A G 10: 90,359,195 N545S probably benign Het
Antxr1 C T 6: 87,269,238 probably null Het
Arhgef17 T C 7: 100,880,621 K476E probably damaging Het
Bptf T C 11: 107,081,262 S927G probably benign Het
Cacna1s C T 1: 136,113,394 T1286I probably benign Het
Ccdc174 T A 6: 91,895,266 M292K probably benign Het
Cdk5rap2 G A 4: 70,410,269 probably benign Het
Celsr3 T A 9: 108,829,073 Y918* probably null Het
Cep250 T C 2: 155,964,974 probably benign Het
Ces2h A G 8: 105,020,271 D513G possibly damaging Het
Clec2l A G 6: 38,663,392 T53A probably benign Het
Cntnap2 C T 6: 45,715,816 S77L probably benign Het
Cped1 A T 6: 22,016,958 H102L probably benign Het
Crim1 T A 17: 78,372,579 D916E probably benign Het
Csmd1 T A 8: 16,233,101 I614F probably damaging Het
Csnk1g1 G A 9: 66,010,469 E37K probably damaging Het
Ctnnbl1 T A 2: 157,871,190 probably null Het
Cuzd1 A T 7: 131,309,872 probably benign Het
Cyp4f16 T A 17: 32,550,551 V433D probably damaging Het
Ddi1 A G 9: 6,266,144 L75P probably damaging Het
Ddias G A 7: 92,859,528 A393V probably benign Het
Dgka A T 10: 128,734,121 Y123* probably null Het
Dlgap1 T C 17: 70,516,190 C57R probably benign Het
Dysf T A 6: 84,152,405 V1458D probably benign Het
Eif2ak4 T A 2: 118,462,347 Y1230N probably damaging Het
Fam160a2 G A 7: 105,384,212 P599L possibly damaging Het
Fam46a T C 9: 85,325,055 Y230C probably damaging Het
Fbxl7 A T 15: 26,543,546 S338R probably benign Het
Fgf23 A T 6: 127,073,159 T44S probably damaging Het
Gpsm2 A T 3: 108,702,394 probably benign Het
Hdac2 T A 10: 36,989,134 probably benign Het
Hist1h2bl A G 13: 21,716,125 probably benign Het
Il31ra G T 13: 112,527,481 T446N possibly damaging Het
Irf5 T A 6: 29,535,370 L199H probably benign Het
Kif18a T A 2: 109,287,843 M1K probably null Het
Kif4-ps A C 12: 101,148,662 I1017L probably benign Het
Klhl2 C T 8: 64,758,130 V295M probably benign Het
Krt75 A T 15: 101,570,311 M296K probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lgr4 T C 2: 110,008,092 S439P probably damaging Het
Lhfpl2 C A 13: 94,174,610 N129K probably damaging Het
Lnx2 A G 5: 147,018,961 V675A probably damaging Het
Med13 T C 11: 86,285,151 T1673A probably benign Het
Mif A G 10: 75,860,140 V10A possibly damaging Het
Mki67 A T 7: 135,699,429 I1292N possibly damaging Het
Mylip C A 13: 45,404,583 N89K probably benign Het
Myo19 G T 11: 84,909,419 D877Y probably benign Het
Nckap5 A G 1: 126,026,365 S753P possibly damaging Het
Nlrc3 T C 16: 3,965,192 T118A possibly damaging Het
Nptx2 T C 5: 144,553,459 Y233H probably damaging Het
Nsl1 T A 1: 191,063,040 M1K probably null Het
Ntsr1 T A 2: 180,501,056 S213R possibly damaging Het
Olfr1225 A T 2: 89,170,631 F194I probably benign Het
Olfr48 A G 2: 89,844,169 V268A probably benign Het
Olfr669 T A 7: 104,938,814 F96Y possibly damaging Het
Pde4d G A 13: 109,936,710 V347I probably benign Het
Pik3r4 T A 9: 105,669,045 S865T probably benign Het
Ppp2r2d A G 7: 138,870,431 R136G probably benign Het
Proser2 A C 2: 6,113,910 S41A probably damaging Het
Proz A T 8: 13,073,460 K244* probably null Het
Prpf38b A T 3: 108,905,270 L209H probably damaging Het
R3hdm1 C A 1: 128,184,517 A390E probably benign Het
Rb1cc1 A C 1: 6,240,323 D315A probably damaging Het
Rnf141 G A 7: 110,837,138 R28* probably null Het
Rps6kc1 A T 1: 190,799,430 S792T probably benign Het
Rxrg A G 1: 167,631,037 D233G possibly damaging Het
Sh2d7 A G 9: 54,541,037 N114S probably benign Het
Slc25a38 T C 9: 120,120,833 V205A probably benign Het
Slc4a10 T C 2: 62,297,017 probably benign Het
Spred1 T A 2: 117,152,978 probably null Het
Stt3b A G 9: 115,248,567 S706P probably benign Het
Tcerg1 C A 18: 42,564,240 probably benign Het
Thsd4 A T 9: 60,002,978 I109N probably damaging Het
Ticrr C A 7: 79,694,488 P1367Q probably damaging Het
Trpv1 A G 11: 73,239,429 D146G probably damaging Het
Tubd1 T G 11: 86,557,776 V305G possibly damaging Het
Tubgcp4 T C 2: 121,175,374 L81P probably benign Het
Ubxn2b T A 4: 6,196,404 probably null Het
Usp36 A T 11: 118,265,194 S586T probably benign Het
Vcan T A 13: 89,678,145 D2220V probably damaging Het
Vmn1r173 T A 7: 23,702,791 N150K probably damaging Het
Vmn1r70 G A 7: 10,634,277 A231T probably damaging Het
Vmn2r97 A G 17: 18,947,668 D728G probably damaging Het
Zbtb40 T C 4: 136,983,228 E1200G probably damaging Het
Zfp365 A T 10: 67,897,606 V252D probably damaging Het
Other mutations in Folh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Folh1 APN 7 86734143 missense probably damaging 1.00
IGL00531:Folh1 APN 7 86719769 missense possibly damaging 0.82
IGL00772:Folh1 APN 7 86731784 missense probably damaging 1.00
IGL01339:Folh1 APN 7 86726098 missense probably damaging 1.00
IGL01373:Folh1 APN 7 86746142 missense probably benign 0.39
IGL01645:Folh1 APN 7 86742227 missense probably damaging 1.00
IGL01736:Folh1 APN 7 86742236 missense possibly damaging 0.96
IGL02104:Folh1 APN 7 86744430 missense possibly damaging 0.93
IGL02124:Folh1 APN 7 86725418 missense probably damaging 0.99
IGL02338:Folh1 APN 7 86736515 splice site probably benign
IGL02440:Folh1 APN 7 86734104 missense probably benign 0.09
IGL02689:Folh1 APN 7 86763045 splice site probably null
IGL02976:Folh1 APN 7 86762918 missense probably benign
IGL03022:Folh1 APN 7 86746171 missense possibly damaging 0.76
R0090:Folh1 UTSW 7 86725868 splice site probably benign
R0285:Folh1 UTSW 7 86742165 splice site probably benign
R0492:Folh1 UTSW 7 86746192 missense probably damaging 1.00
R1079:Folh1 UTSW 7 86771881 missense probably damaging 1.00
R1148:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1148:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1493:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1778:Folh1 UTSW 7 86761699 critical splice donor site probably null
R1865:Folh1 UTSW 7 86725906 missense possibly damaging 0.65
R1878:Folh1 UTSW 7 86771742 missense probably benign
R1906:Folh1 UTSW 7 86742166 splice site probably null
R1912:Folh1 UTSW 7 86762967 missense possibly damaging 0.95
R2263:Folh1 UTSW 7 86719765 missense probably benign
R3001:Folh1 UTSW 7 86723311 missense probably damaging 1.00
R3002:Folh1 UTSW 7 86723311 missense probably damaging 1.00
R3883:Folh1 UTSW 7 86775656 missense possibly damaging 0.48
R4061:Folh1 UTSW 7 86756962 missense possibly damaging 0.49
R4277:Folh1 UTSW 7 86762915 critical splice donor site probably null
R4507:Folh1 UTSW 7 86757008 missense probably benign
R4627:Folh1 UTSW 7 86773252 missense probably benign 0.00
R4652:Folh1 UTSW 7 86744425 nonsense probably null
R4653:Folh1 UTSW 7 86744425 nonsense probably null
R4745:Folh1 UTSW 7 86723274 critical splice donor site probably null
R5571:Folh1 UTSW 7 86734120 missense probably damaging 1.00
R6000:Folh1 UTSW 7 86725934 missense probably benign 0.01
R6307:Folh1 UTSW 7 86723309 missense probably damaging 1.00
R6474:Folh1 UTSW 7 86775756 missense probably damaging 0.99
R7112:Folh1 UTSW 7 86775637 critical splice donor site probably null
R7131:Folh1 UTSW 7 86726112 missense probably damaging 1.00
R7449:Folh1 UTSW 7 86731748 missense probably benign 0.00
R7494:Folh1 UTSW 7 86719699 missense probably damaging 1.00
R7539:Folh1 UTSW 7 86725909 missense probably benign 0.35
R7764:Folh1 UTSW 7 86762918 missense probably benign
R7803:Folh1 UTSW 7 86726098 missense probably damaging 1.00
R8105:Folh1 UTSW 7 86746146 missense probably damaging 1.00
R8208:Folh1 UTSW 7 86725917 missense probably damaging 0.98
RF007:Folh1 UTSW 7 86775687 missense probably benign
Z1088:Folh1 UTSW 7 86725954 missense probably benign 0.00
Z1177:Folh1 UTSW 7 86744447 missense probably damaging 1.00
Z1177:Folh1 UTSW 7 86761822 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCAGTTTATCACTCTCACTTGTCCC -3'
(R):5'- TGGCTTTGCTGGAAACTTTTCAACAC -3'

Sequencing Primer
(F):5'- ATCACTCTCACTTGTCCCCATAC -3'
(R):5'- agataggagggagaaggaatgg -3'
Posted On2013-05-23