Incidental Mutation 'R0487:Zap70'
ID42318
Institutional Source Beutler Lab
Gene Symbol Zap70
Ensembl Gene ENSMUSG00000026117
Gene Namezeta-chain (TCR) associated protein kinase
SynonymsZAP-70, TZK, Srk
MMRRC Submission 038686-MU
Accession Numbers

Genbank: NM_009539; MGI: 99613

 

Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R0487 (G1)
Quality Score190
Status Not validated
Chromosome1
Chromosomal Location36761798-36782818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36779284 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 351 (V351L)
Ref Sequence ENSEMBL: ENSMUSP00000027291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027291]
Predicted Effect probably damaging
Transcript: ENSMUST00000027291
AA Change: V351L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: V351L

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190128
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,331,687 M3190L probably benign Het
Adgrv1 A T 13: 81,489,035 L3429H probably damaging Het
Ahnak A G 19: 9,007,151 N1933S probably benign Het
Ahnak A G 19: 9,014,120 D4256G probably damaging Het
AI314180 A G 4: 58,819,155 V1265A probably damaging Het
Amacr A G 15: 10,984,749 D151G probably benign Het
Ano9 A T 7: 141,107,849 H255Q possibly damaging Het
Asphd2 A T 5: 112,391,635 Y111N probably damaging Het
Cage1 T A 13: 38,025,358 K214N probably benign Het
Cdkn2c A G 4: 109,661,409 L116P probably damaging Het
Cltc C T 11: 86,733,664 R148H probably damaging Het
Cmbl A G 15: 31,582,030 N58D probably damaging Het
Cpa6 T C 1: 10,409,262 T249A possibly damaging Het
Cpsf1 T A 15: 76,597,002 N1218I probably damaging Het
Csf2rb T C 15: 78,348,331 S613P probably benign Het
Ctnnd1 A G 2: 84,609,067 S761P probably damaging Het
Cxcr6 A C 9: 123,810,398 I155L probably benign Het
Fam216a A G 5: 122,370,513 probably null Het
Fgf10 T A 13: 118,781,611 probably null Het
Fgf17 T C 14: 70,638,556 T79A probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm1527 G T 3: 28,926,679 V643L probably benign Het
Gm7534 A T 4: 134,202,778 L72Q probably damaging Het
Hmcn2 A T 2: 31,386,677 Q1556L possibly damaging Het
Hrasls G A 16: 29,220,579 probably null Het
Hspa4l C T 3: 40,784,326 T616I possibly damaging Het
Irgm1 T C 11: 48,866,327 D219G probably damaging Het
Jcad A G 18: 4,673,243 D335G probably damaging Het
Kcnh4 A G 11: 100,750,258 F455S probably damaging Het
Khdrbs3 T C 15: 69,017,361 Y120H probably damaging Het
Kndc1 A T 7: 139,914,023 T507S probably null Het
Lepr G T 4: 101,768,093 E482* probably null Het
Lrmp A G 6: 145,165,260 S264G probably benign Het
Mcemp1 T A 8: 3,667,507 M146K probably benign Het
Mllt10 A G 2: 18,207,137 T411A probably damaging Het
Myh8 A T 11: 67,302,011 I1543L probably benign Het
Myo1f T C 17: 33,578,284 S147P probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Olfr1106 C T 2: 87,048,493 V248I probably damaging Het
Plch2 G A 4: 155,009,012 R57C probably damaging Het
Rbm20 G A 19: 53,851,195 G872R probably damaging Het
Retsat A T 6: 72,606,431 I373F probably damaging Het
Rnf145 T C 11: 44,555,229 F297L probably benign Het
Ros1 A T 10: 52,155,108 M479K possibly damaging Het
Rubcnl T A 14: 75,036,081 N244K probably benign Het
Samhd1 A G 2: 157,110,615 F406L probably damaging Het
Sdsl A T 5: 120,459,468 V258D probably damaging Het
Sec24c C G 14: 20,683,399 P166A probably benign Het
Sele C A 1: 164,053,615 Y461* probably null Het
Slc22a1 G T 17: 12,662,600 S334* probably null Het
Spem1 T G 11: 69,821,865 probably null Het
Stat3 T C 11: 100,903,643 E280G probably damaging Het
Stxbp4 T C 11: 90,592,360 H280R probably benign Het
Tas2r129 G A 6: 132,951,943 C281Y probably benign Het
Tas2r129 T G 6: 132,951,944 C281W probably benign Het
Tcp11 T A 17: 28,079,923 probably null Het
Tnrc6b G A 15: 80,880,675 V793M probably benign Het
Vmn2r59 A C 7: 42,047,104 Y71* probably null Het
Wdr35 T C 12: 9,012,743 probably null Het
Zan A G 5: 137,413,358 probably null Het
Zfp609 G T 9: 65,702,634 Q1016K unknown Het
Zfp641 C A 15: 98,289,179 V188L probably benign Het
Other mutations in Zap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense probably damaging 0.99
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 splice site probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense probably damaging 1.00
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
want_to UTSW 1 36782517 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
zipper UTSW 1 36770902 missense probably benign 0.09
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36778390 missense probably damaging 1.00
R7039:Zap70 UTSW 1 36778751 missense probably benign
R7704:Zap70 UTSW 1 36779314 critical splice donor site probably null
R7769:Zap70 UTSW 1 36770902 missense probably benign 0.09
R8115:Zap70 UTSW 1 36781206 missense probably damaging 1.00
R8289:Zap70 UTSW 1 36781137 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Z1176:Zap70 UTSW 1 36779176 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGCAATGCTTAGTCATCACGCC -3'
(R):5'- TCTCAGTCAGAGACACCTTCCCAG -3'

Sequencing Primer
(F):5'- TGTATATCCTAGTGTATGCCACG -3'
(R):5'- AGACACCTTCCCAGGGAGTG -3'
Posted On2013-05-23