Mutagenetix > Incidental Mutation

Incidental Mutation 'R5377:B4galnt1'

425629

Institutional Source

Beutler Lab

Gene Symbol

B4galnt1

Ensembl Gene

ENSMUSG00000006731

Gene Name

beta-1,4-N-acetyl-galactosaminyl transferase 1

Synonyms

Ggm2, Gal-NAc-T, GalNAcT, beta1,4GalNAC-T, GalNAc-T, Ggm-2, GM2/GD2 synthase, 4933429D13Rik, Galgt1

MMRRC Submission

042845-MU

Accession Numbers

Genbank: NM_008080; MGI: 1342057

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5377 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

127165225-127172330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 127171822 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 531 (T531A)

Ref Sequence

ENSEMBL: ENSMUSP00000006914 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006914] [ENSMUST00000095270] [ENSMUST00000217678] [ENSMUST00000222911]

AlphaFold

Q09200

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006914
AA Change: T531A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000006914
Gene: ENSMUSG00000006731
AA Change: T531A

Domain	Start	End	E-Value	Type
transmembrane domain	7	24	N/A	INTRINSIC
low complexity region	191	202	N/A	INTRINSIC
Pfam:Glycos_transf_2	280	450	7e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000095270

SMART Domains

Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441

Domain	Start	End	E-Value	Type
low complexity region	51	78	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
Pfam:Sulfate_transp	105	497	5.5e-103	PFAM
low complexity region	512	522	N/A	INTRINSIC
Pfam:STAS	549	664	3.3e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217678

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218658

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218977

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220055

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220327

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221174

Predicted Effect

probably benign
Transcript: ENSMUST00000222911

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GM2 and GD2 gangliosides are sialic acid-containing glycosphingolipids. GalNAc-T is the enzyme involved in the biosynthesis of G(M2) and G(D2) glycosphingolipids. GalNAc-T catalyzes the transfer of GalNAc into G(M3) and G(D3) by a beta-1,4 linkage, resulting in the synthesis of G(M2) and G(D2), respectively. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for one knock-out allele lack all complex gangliosides but show normal brain histology and gross behavior with only subtle defects in neural conduction velocities. Mice homozygous for another knock-out allele exhibit male infertility due to degeneration of the seminiferous tubules. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,645,253	V372F	probably benign	Het
Adcy10	G	A	1: 165,519,895	C393Y	probably damaging	Het
Adgrg7	A	C	16: 56,730,306	I681S	possibly damaging	Het
Akap8l	T	C	17: 32,321,511		probably benign	Het
Akr1a1	A	T	4: 116,639,895	V156E	probably damaging	Het
Alk	T	G	17: 71,895,739	D1167A	probably damaging	Het
Ankrd11	T	C	8: 122,893,714		probably null	Het
Aspm	T	A	1: 139,457,483	N288K	probably damaging	Het
Aspm	A	G	1: 139,470,395		probably null	Het
Asxl2	G	A	12: 3,474,618		probably null	Het
Atp6v0a1	A	G	11: 101,055,587	H802R	probably damaging	Het
Ccdc114	C	T	7: 45,942,082	R257*	probably null	Het
Cecr2	A	G	6: 120,756,569	N506D	possibly damaging	Het
Crebrf	T	C	17: 26,759,865	V509A	probably damaging	Het
Cyp4f40	A	T	17: 32,675,616	I413F	probably null	Het
Defb12	C	A	8: 19,114,326		probably null	Het
Dnah2	T	C	11: 69,421,848	E4297G	probably damaging	Het
Dpysl5	A	T	5: 30,791,513	N371Y	probably damaging	Het
Eef1d	G	T	15: 75,903,189	T207N	probably benign	Het
Esrrb	C	T	12: 86,519,009	Q416*	probably null	Het
Exd2	T	C	12: 80,489,448	L284P	probably damaging	Het
Fat3	T	A	9: 16,376,443	I595F	probably benign	Het
Gm9920	A	G	15: 55,108,975		probably benign	Het
Hephl1	T	C	9: 15,069,788	K783E	probably damaging	Het
Irs2	A	G	8: 11,005,277	S1052P	probably benign	Het
Kctd18	T	C	1: 57,963,093	I192V	probably benign	Het
Lama3	A	G	18: 12,453,746	D722G	probably damaging	Het
Lepr	T	C	4: 101,815,019	V1080A	possibly damaging	Het
Lpin1	C	T	12: 16,563,655	G504S	probably damaging	Het
Lrit2	A	C	14: 37,069,183	Q273P	possibly damaging	Het
Mgea5	A	T	19: 45,758,022	Y779*	probably null	Het
Mlkl	T	A	8: 111,327,937	E189D	probably benign	Het
Mttp	C	T	3: 138,105,029	R608H	probably benign	Het
Nav2	T	C	7: 49,589,160	V2011A	probably benign	Het
Nos2	A	T	11: 78,957,491	I1075F	probably benign	Het
Npat	A	G	9: 53,550,036		probably null	Het
Nucks1	T	C	1: 131,919,033	F16L	probably damaging	Het
Nus1	T	C	10: 52,429,213	S150P	possibly damaging	Het
Olfr1230	G	T	2: 89,297,162	T36K	probably damaging	Het
Olfr881	A	T	9: 37,992,612	Y40F	probably benign	Het
Pclo	A	G	5: 14,681,353	T3290A	unknown	Het
Pign	A	T	1: 105,657,812	F4Y	probably benign	Het
Rfx4	A	G	10: 84,860,542	N233D	possibly damaging	Het
Rpgrip1	A	T	14: 52,160,195	M1325L	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Scaf11	T	A	15: 96,417,120	H1227L	possibly damaging	Het
Sec31b	G	T	19: 44,518,637	P840T	probably damaging	Het
Slc16a9	T	A	10: 70,283,128	L426I	probably damaging	Het
Slc17a2	T	C	13: 23,812,592	S27P	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Tacc1	A	G	8: 25,182,283	S310P	possibly damaging	Het
Tmem245	G	A	4: 56,947,084	R110C	probably damaging	Het
Trip12	T	C	1: 84,757,431	Y953C	probably damaging	Het
Trpm7	C	A	2: 126,842,855		probably null	Het
Ush2a	G	A	1: 188,912,123	V4561I	probably benign	Het
Vmn1r192	C	T	13: 22,187,631	V140I	probably benign	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	T	C	17: 19,379,269	V405A	probably damaging	Het
Wdhd1	A	C	14: 47,272,221	V172G	probably benign	Het
Zfhx3	C	T	8: 108,951,185	R2956C	possibly damaging	Het
Zfp446	T	C	7: 12,982,251	L283P	possibly damaging	Het
Zfp82	T	C	7: 30,057,166	K164E	probably damaging	Het

Other mutations in B4galnt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00858:B4galnt1	APN	10	127167764	missense	probably benign	0.01
IGL01087:B4galnt1	APN	10	127166191	missense	probably damaging	1.00
IGL01301:B4galnt1	APN	10	127169779	missense	possibly damaging	0.56
IGL01924:B4galnt1	APN	10	127166761	missense	probably benign	0.01
IGL02996:B4galnt1	APN	10	127167003	missense	probably damaging	1.00
Hypokalemic	UTSW	10	127171793	splice site	probably null
ANU18:B4galnt1	UTSW	10	127169779	missense	possibly damaging	0.56
R0233:B4galnt1	UTSW	10	127170911	unclassified	probably benign
R4646:B4galnt1	UTSW	10	127167836	missense	probably damaging	0.99
R4702:B4galnt1	UTSW	10	127167525	missense	possibly damaging	0.90
R4703:B4galnt1	UTSW	10	127167525	missense	possibly damaging	0.90
R4705:B4galnt1	UTSW	10	127167525	missense	possibly damaging	0.90
R4708:B4galnt1	UTSW	10	127169815	missense	probably damaging	1.00
R6644:B4galnt1	UTSW	10	127171793	splice site	probably null
R7006:B4galnt1	UTSW	10	127169831	missense	probably benign	0.00
R7278:B4galnt1	UTSW	10	127167788	missense	probably benign	0.01
R7396:B4galnt1	UTSW	10	127171616	missense	possibly damaging	0.89
R7886:B4galnt1	UTSW	10	127167054	missense	probably damaging	0.99
R7935:B4galnt1	UTSW	10	127171621	missense	probably damaging	1.00
R8738:B4galnt1	UTSW	10	127171715	missense	probably benign	0.28
R9057:B4galnt1	UTSW	10	127171130	missense	probably damaging	1.00
R9520:B4galnt1	UTSW	10	127170711	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGAATTCTTCCTGGATGGACTTGG -3'
(R):5'- TCTGGTCGCTCACAGAAAGG -3'

Sequencing Primer
(F):5'- CCTGGATGGACTTGGTTTCC -3'
(R):5'- CTCACAGAAAGGAAGGGTGTCAC -3'

Posted On

2016-08-04