Incidental Mutation 'R4935:Olfr1487'
ID380333
Institutional Source Beutler Lab
Gene Symbol Olfr1487
Ensembl Gene ENSMUSG00000094846
Gene Nameolfactory receptor 1487
SynonymsMOR202-18, GA_x6K02T2RE5P-3951719-3952666
MMRRC Submission 042535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4935 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13617375-13623072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13619702 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 180 (I180T)
Ref Sequence ENSEMBL: ENSMUSP00000149988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076856] [ENSMUST00000208347] [ENSMUST00000209005] [ENSMUST00000216688] [ENSMUST00000217061]
Predicted Effect probably benign
Transcript: ENSMUST00000076856
AA Change: I180T

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076128
Gene: ENSMUSG00000094846
AA Change: I180T

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-55 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1e-6 PFAM
Pfam:7tm_1 40 289 9.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208347
Predicted Effect probably benign
Transcript: ENSMUST00000209005
AA Change: I137T

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000216688
AA Change: I137T

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000217061
AA Change: I180T

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 86.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A G 11: 6,200,442 *138W probably null Het
Abcb1a T A 5: 8,737,773 probably null Het
Acp6 T C 3: 97,171,744 probably null Het
Adcyap1 A T 17: 93,204,113 I172L probably benign Het
Adgrf1 A C 17: 43,295,239 I85L probably benign Het
Afdn A T 17: 13,890,966 T1604S probably benign Het
Angpt2 T C 8: 18,692,115 Y475C probably damaging Het
Ank2 A G 3: 126,956,064 S439P probably damaging Het
Ank3 T A 10: 69,976,203 N366K probably damaging Het
Ankrd11 A G 8: 122,900,183 S87P probably benign Het
Ano7 T A 1: 93,395,314 S459T possibly damaging Het
Asxl3 G A 18: 22,523,312 V1460M probably benign Het
Atg16l1 A C 1: 87,767,042 N147T possibly damaging Het
Atp10a T C 7: 58,813,764 V1015A probably damaging Het
Atxn7 T A 14: 14,100,401 S696T probably benign Het
Babam1 C T 8: 71,399,802 T184I probably benign Het
Blk A G 14: 63,381,262 S175P possibly damaging Het
Col5a1 T A 2: 28,024,742 F123L probably damaging Het
Csmd3 T C 15: 48,161,084 Y496C probably damaging Het
Dnah3 A T 7: 120,016,477 Y1676* probably null Het
Fdxacb1 T A 9: 50,771,943 M402K probably benign Het
Frmd5 A G 2: 121,562,924 V141A possibly damaging Het
Gapvd1 G A 2: 34,704,492 R685* probably null Het
Grik2 A G 10: 49,240,730 L645P probably damaging Het
H2afj T A 6: 136,808,683 V115E possibly damaging Het
Hrh3 T C 2: 180,101,268 Y189C probably damaging Het
Kcnc2 A G 10: 112,272,228 T175A probably benign Het
Kcnv2 A G 19: 27,322,932 Y61C probably damaging Het
Kif24 T C 4: 41,394,939 R645G probably damaging Het
Knl1 A G 2: 119,068,957 I380V possibly damaging Het
Lamb2 A G 9: 108,487,501 I1151M possibly damaging Het
Leo1 A G 9: 75,445,877 D234G probably benign Het
Lrp1b T G 2: 41,498,393 N407H probably benign Het
Matn2 T C 15: 34,428,685 S732P probably damaging Het
Mrps30 A T 13: 118,386,895 F114I possibly damaging Het
Olfr1293-ps G A 2: 111,527,448 V45I probably damaging Het
Olfr355 T C 2: 36,927,701 N138D probably benign Het
Oxr1 T C 15: 41,813,584 V179A probably benign Het
Plaur A T 7: 24,466,716 S71C possibly damaging Het
Plbd2 T C 5: 120,486,721 N461D possibly damaging Het
Plcb2 T A 2: 118,718,915 Y322F probably damaging Het
Prkab2 T C 3: 97,662,355 V79A probably damaging Het
Ptpn3 A T 4: 57,197,568 C774S probably damaging Het
Ring1 A C 17: 34,023,042 L131R probably benign Het
Rxfp2 G A 5: 150,051,632 probably null Het
Selenbp1 A T 3: 94,937,958 I122F probably benign Het
Sept7 A G 9: 25,306,172 H394R probably benign Het
Slc1a7 G A 4: 108,007,561 V266I probably damaging Het
Slc2a10 A G 2: 165,517,658 T481A probably benign Het
Tapbp A G 17: 33,925,622 M231V probably benign Het
Tbxas1 A T 6: 39,023,047 N256I probably benign Het
Thegl T C 5: 77,037,353 probably null Het
Uimc1 A G 13: 55,093,185 I30T probably damaging Het
Usp48 C A 4: 137,650,358 N231K probably benign Het
Zfhx3 T G 8: 108,947,850 V1844G possibly damaging Het
Znrf3 A T 11: 5,283,422 C212S probably damaging Het
Other mutations in Olfr1487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Olfr1487 APN 19 13619746 missense probably damaging 1.00
R0281:Olfr1487 UTSW 19 13619485 missense probably benign 0.00
R0847:Olfr1487 UTSW 19 13619551 missense probably benign 0.10
R1852:Olfr1487 UTSW 19 13619603 missense probably damaging 0.99
R2026:Olfr1487 UTSW 19 13619581 missense probably damaging 1.00
R2877:Olfr1487 UTSW 19 13619632 missense probably damaging 0.97
R3965:Olfr1487 UTSW 19 13619201 missense probably damaging 1.00
R5148:Olfr1487 UTSW 19 13619510 nonsense probably null
R5210:Olfr1487 UTSW 19 13619399 missense probably damaging 1.00
R5427:Olfr1487 UTSW 19 13619350 missense probably benign 0.31
R5940:Olfr1487 UTSW 19 13619153 unclassified probably null
R6110:Olfr1487 UTSW 19 13619885 missense probably benign 0.03
R6125:Olfr1487 UTSW 19 13619885 missense probably benign 0.03
R6294:Olfr1487 UTSW 19 13619366 missense probably benign 0.08
R7051:Olfr1487 UTSW 19 13619405 missense possibly damaging 0.94
R7052:Olfr1487 UTSW 19 13619626 missense probably benign 0.13
R7324:Olfr1487 UTSW 19 13619578 missense probably benign
R7655:Olfr1487 UTSW 19 13619833 missense probably damaging 0.99
R7656:Olfr1487 UTSW 19 13619833 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACTGTTGAAAGTTTCATGCTGGC -3'
(R):5'- CACAGGTGGAAATGGCCTTC -3'

Sequencing Primer
(F):5'- AATGGCCTATGACCGTCATG -3'
(R):5'- GTGGAAATGGCCTTCTTCCTGC -3'
Posted On2016-04-15