Incidental Mutation 'R2877:Olfr1487'
ID260641
Institutional Source Beutler Lab
Gene Symbol Olfr1487
Ensembl Gene ENSMUSG00000094846
Gene Nameolfactory receptor 1487
SynonymsMOR202-18, GA_x6K02T2RE5P-3951719-3952666
MMRRC Submission 040465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2877 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13617375-13623072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13619632 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 157 (I157F)
Ref Sequence ENSEMBL: ENSMUSP00000149988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076856] [ENSMUST00000208347] [ENSMUST00000209005] [ENSMUST00000216688] [ENSMUST00000217061]
Predicted Effect probably damaging
Transcript: ENSMUST00000076856
AA Change: I157F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076128
Gene: ENSMUSG00000094846
AA Change: I157F

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-55 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1e-6 PFAM
Pfam:7tm_1 40 289 9.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208347
Predicted Effect possibly damaging
Transcript: ENSMUST00000209005
AA Change: I114F

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216688
AA Change: I114F

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000217061
AA Change: I157F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A C 5: 109,738,945 probably benign Het
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adssl1 A C 12: 112,634,189 K197N probably damaging Het
Alg11 A G 8: 22,065,358 N170D possibly damaging Het
Ambn T C 5: 88,460,700 probably benign Het
Anapc7 T C 5: 122,428,156 Y43H probably benign Het
Anxa10 T A 8: 62,060,339 I255F probably damaging Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Axl T A 7: 25,766,524 M563L probably damaging Het
Carmil2 A G 8: 105,695,423 E1108G probably damaging Het
Casp1 T C 9: 5,303,110 M188T probably damaging Het
Chd3 A T 11: 69,361,172 C87* probably null Het
Col6a3 G A 1: 90,775,599 T2475I unknown Het
Creb3l4 A T 3: 90,242,308 S83R probably damaging Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eif3f G A 7: 108,934,812 probably null Het
Eipr1 C T 12: 28,760,092 T22I possibly damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Foxa3 A T 7: 19,014,880 M107K probably benign Het
Foxj2 G A 6: 122,842,832 D560N probably damaging Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gpr25 C T 1: 136,260,815 G20D possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Kiz T C 2: 146,889,556 V322A possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc19 T A 15: 91,893,006 noncoding transcript Het
Naa16 A G 14: 79,343,298 M592T probably benign Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Ncapd3 T A 9: 27,044,487 probably null Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nedd1 T A 10: 92,714,126 N99I possibly damaging Het
Nuak1 T C 10: 84,375,345 D293G possibly damaging Het
Olfr1036 T C 2: 86,075,331 M197T possibly damaging Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rassf6 C T 5: 90,606,805 V205I probably damaging Het
Rbak A G 5: 143,174,105 Y398H probably damaging Het
Rcbtb1 A G 14: 59,210,592 probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Smpdl3a C A 10: 57,809,085 T317K probably damaging Het
Speer4e C T 5: 14,937,116 V92M probably damaging Het
Syne2 A G 12: 76,000,831 I4009V probably benign Het
Tarbp1 G A 8: 126,427,832 L1474F probably damaging Het
Tchh A G 3: 93,444,228 E325G unknown Het
Trpc4 T C 3: 54,291,340 S562P probably damaging Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Vmn1r215 A G 13: 23,076,561 H257R probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Vmn2r76 C A 7: 86,225,993 C592F probably benign Het
Zcchc8 C T 5: 123,700,703 V591I probably benign Het
Znhit6 G C 3: 145,576,654 G96A probably benign Het
Other mutations in Olfr1487
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Olfr1487 APN 19 13619746 missense probably damaging 1.00
R0281:Olfr1487 UTSW 19 13619485 missense probably benign 0.00
R0847:Olfr1487 UTSW 19 13619551 missense probably benign 0.10
R1852:Olfr1487 UTSW 19 13619603 missense probably damaging 0.99
R2026:Olfr1487 UTSW 19 13619581 missense probably damaging 1.00
R3965:Olfr1487 UTSW 19 13619201 missense probably damaging 1.00
R4935:Olfr1487 UTSW 19 13619702 missense probably benign 0.11
R5148:Olfr1487 UTSW 19 13619510 nonsense probably null
R5210:Olfr1487 UTSW 19 13619399 missense probably damaging 1.00
R5427:Olfr1487 UTSW 19 13619350 missense probably benign 0.31
R5940:Olfr1487 UTSW 19 13619153 splice site probably null
R6110:Olfr1487 UTSW 19 13619885 missense probably benign 0.03
R6125:Olfr1487 UTSW 19 13619885 missense probably benign 0.03
R6294:Olfr1487 UTSW 19 13619366 missense probably benign 0.08
R7051:Olfr1487 UTSW 19 13619405 missense possibly damaging 0.94
R7052:Olfr1487 UTSW 19 13619626 missense probably benign 0.13
R7324:Olfr1487 UTSW 19 13619578 missense probably benign
R7655:Olfr1487 UTSW 19 13619833 missense probably damaging 0.99
R7656:Olfr1487 UTSW 19 13619833 missense probably damaging 0.99
R7807:Olfr1487 UTSW 19 13619921 missense probably damaging 0.99
R7876:Olfr1487 UTSW 19 13619264 missense probably damaging 1.00
R8118:Olfr1487 UTSW 19 13619745 missense probably damaging 1.00
R8370:Olfr1487 UTSW 19 13619297 missense probably damaging 1.00
Z1176:Olfr1487 UTSW 19 13619662 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTGCTGCCCAGATGTTCTTC -3'
(R):5'- AGCGCATTCTCAGAATTGCAAC -3'

Sequencing Primer
(F):5'- GCCCAGATGTTCTTCTTTGCAG -3'
(R):5'- GCTGCCAACATAAAGAGT -3'
Posted On2015-01-23