Incidental Mutation 'R5369:Soga1'
ID429522
Institutional Source Beutler Lab
Gene Symbol Soga1
Ensembl Gene ENSMUSG00000055485
Gene Namesuppressor of glucose, autophagy associated 1
SynonymsD430036N24Rik, 9830001H06Rik
MMRRC Submission 042946-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R5369 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location157015799-157079254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157040734 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 466 (E466G)
Ref Sequence ENSEMBL: ENSMUSP00000066556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069098]
Predicted Effect probably damaging
Transcript: ENSMUST00000069098
AA Change: E466G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066556
Gene: ENSMUSG00000055485
AA Change: E466G

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
low complexity region 51 66 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
low complexity region 132 148 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
Blast:BRLZ 212 246 4e-8 BLAST
SCOP:d1fxkc_ 216 350 1e-3 SMART
Pfam:DUF3166 378 472 2.3e-31 PFAM
Pfam:DUF3166 504 593 5.3e-31 PFAM
low complexity region 637 649 N/A INTRINSIC
coiled coil region 807 867 N/A INTRINSIC
low complexity region 872 884 N/A INTRINSIC
low complexity region 938 950 N/A INTRINSIC
Pfam:DUF4482 1065 1205 3.9e-28 PFAM
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1363 1377 N/A INTRINSIC
low complexity region 1389 1418 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133571
Meta Mutation Damage Score 0.1493 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T A 6: 41,033,006 R131S probably benign Het
A2ml1 T C 6: 128,568,833 T444A probably damaging Het
A330070K13Rik G A 5: 130,379,091 probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Acbd5 T A 2: 23,112,510 L508Q probably damaging Het
Asb15 T C 6: 24,562,564 V175A probably benign Het
B3galnt2 T C 13: 13,994,425 probably null Het
BC024139 A C 15: 76,120,222 S711R probably benign Het
Bod1l A G 5: 41,827,183 I508T probably damaging Het
Btnl6 T A 17: 34,507,985 R524* probably null Het
C3 C A 17: 57,221,159 D687Y probably benign Het
Ccbe1 G A 18: 66,061,414 A367V probably benign Het
Ccr1 A T 9: 123,964,289 M68K probably damaging Het
Cd27 T A 6: 125,234,364 probably benign Het
Celf2 C A 2: 7,081,081 probably benign Het
Cfap54 T C 10: 93,061,257 probably benign Het
Cfap97 A G 8: 46,169,650 K26E probably damaging Het
Clcn4 T A 7: 7,296,033 I48F probably benign Het
Cnot7 A T 8: 40,494,020 N238K probably benign Het
Colec12 A G 18: 9,866,750 I654V unknown Het
Dip2a A G 10: 76,292,360 I22T probably damaging Het
Eif4g3 C T 4: 138,183,334 T1375M possibly damaging Het
Eml5 C T 12: 98,858,783 G725D probably damaging Het
F12 T C 13: 55,418,491 E496G probably benign Het
Fam227a A T 15: 79,615,436 S573T probably benign Het
Fnip1 T C 11: 54,502,589 V593A probably benign Het
Focad T A 4: 88,121,373 probably benign Het
Frem1 A G 4: 83,001,739 I460T possibly damaging Het
Galnt10 T G 11: 57,765,747 probably null Het
Gm5592 A T 7: 41,218,211 probably benign Het
Gm6185 A T 1: 161,209,760 noncoding transcript Het
Gm7935 A T 15: 74,081,114 noncoding transcript Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Gstm5 G A 3: 107,898,466 A198T probably damaging Het
Herc2 T A 7: 56,182,700 V3048D probably damaging Het
Htra4 T G 8: 25,033,569 I327L possibly damaging Het
Ifi209 T C 1: 173,637,307 M1T probably null Het
Ints6 T C 14: 62,743,935 T135A probably damaging Het
Itpr1 T A 6: 108,519,424 I2604N probably damaging Het
Krt6a T A 15: 101,692,558 M268L probably benign Het
Lrp1b G T 2: 41,004,613 S2201* probably null Het
Lrp2 T C 2: 69,459,560 N3645S probably benign Het
Lrrc15 A T 16: 30,272,904 I539N possibly damaging Het
Map3k6 T C 4: 133,247,681 I675T probably damaging Het
Map3k9 T A 12: 81,722,052 E1074V probably damaging Het
Med13l T A 5: 118,724,010 S339R probably benign Het
Mrps18a T C 17: 46,125,626 probably benign Het
Nat8f2 G T 6: 85,867,872 Y169* probably null Het
Nlrp1b A G 11: 71,181,799 I406T probably benign Het
Npc1l1 A G 11: 6,217,705 probably null Het
Olfr202 A T 16: 59,284,380 M39K probably damaging Het
Olfr419 A G 1: 174,250,441 V162A probably damaging Het
Ostf1 C T 19: 18,581,325 G198E probably benign Het
Pcsk5 A G 19: 17,581,255 V596A probably damaging Het
Pde4c T C 8: 70,750,105 *647Q probably null Het
Pkm A T 9: 59,670,634 I245F probably damaging Het
Ptprj T C 2: 90,469,641 H179R probably benign Het
Rapgef2 A T 3: 79,069,432 S1356T probably benign Het
Rbm45 T A 2: 76,370,250 L41Q probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scel A T 14: 103,586,493 I386F probably benign Het
Serpinb5 A T 1: 106,881,757 N298Y possibly damaging Het
Sirt3 A T 7: 140,869,493 L180Q probably damaging Het
Slc24a2 C T 4: 86,991,388 V698I probably damaging Het
Slc43a3 A T 2: 84,957,723 H483L probably damaging Het
Snrnp35 A G 5: 124,490,199 D25G probably benign Het
Snrnp40 T C 4: 130,362,646 S55P probably damaging Het
Snx9 T A 17: 5,920,580 C399S probably damaging Het
Ttbk2 T C 2: 120,825,262 probably benign Het
Vmn1r1 A G 1: 182,157,776 V108A possibly damaging Het
Vmn1r201 T A 13: 22,475,502 N295K probably benign Het
Zfp292 G A 4: 34,807,491 P1851L possibly damaging Het
Zfp472 A T 17: 32,977,743 D264V probably damaging Het
Other mutations in Soga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Soga1 APN 2 157030864 missense probably damaging 1.00
IGL00924:Soga1 APN 2 157040705 missense probably damaging 0.99
IGL01723:Soga1 APN 2 157030614 missense probably benign 0.00
IGL01749:Soga1 APN 2 157021541 splice site probably benign
IGL02199:Soga1 APN 2 157030945 missense probably damaging 1.00
IGL02262:Soga1 APN 2 157030906 missense probably damaging 1.00
IGL02618:Soga1 APN 2 157040566 missense probably damaging 1.00
IGL02643:Soga1 APN 2 157040743 missense probably damaging 1.00
deglutition UTSW 2 157039864 missense possibly damaging 0.63
gulp UTSW 2 157023817 nonsense probably null
IGL02835:Soga1 UTSW 2 157041934 missense possibly damaging 0.91
R0528:Soga1 UTSW 2 157020692 missense probably damaging 1.00
R0535:Soga1 UTSW 2 157033289 missense possibly damaging 0.89
R0726:Soga1 UTSW 2 157060262 missense probably damaging 1.00
R1473:Soga1 UTSW 2 157020448 nonsense probably null
R1589:Soga1 UTSW 2 157027637 missense probably benign 0.05
R1615:Soga1 UTSW 2 157020743 missense probably damaging 1.00
R1681:Soga1 UTSW 2 157030530 missense possibly damaging 0.70
R1701:Soga1 UTSW 2 157030619 missense probably damaging 1.00
R1872:Soga1 UTSW 2 157040261 missense possibly damaging 0.88
R2056:Soga1 UTSW 2 157022827 missense probably benign 0.00
R2118:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2120:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2121:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2124:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2249:Soga1 UTSW 2 157040093 missense probably benign 0.08
R3147:Soga1 UTSW 2 157020364 missense possibly damaging 0.91
R3758:Soga1 UTSW 2 157020638 missense possibly damaging 0.77
R4601:Soga1 UTSW 2 157039924 missense probably benign 0.41
R4646:Soga1 UTSW 2 157020506 missense probably damaging 1.00
R4653:Soga1 UTSW 2 157040591 missense probably damaging 1.00
R4736:Soga1 UTSW 2 157020554 missense probably damaging 1.00
R4773:Soga1 UTSW 2 157030569 missense probably benign 0.08
R4796:Soga1 UTSW 2 157020252 missense probably benign
R4999:Soga1 UTSW 2 157022856 missense probably benign 0.10
R5304:Soga1 UTSW 2 157023817 nonsense probably null
R5530:Soga1 UTSW 2 157020342 missense probably damaging 1.00
R5712:Soga1 UTSW 2 157030921 missense probably damaging 1.00
R5780:Soga1 UTSW 2 157018490 missense probably damaging 0.98
R6162:Soga1 UTSW 2 157039864 missense possibly damaging 0.63
R6253:Soga1 UTSW 2 157021419 missense probably benign 0.00
R6303:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6304:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6523:Soga1 UTSW 2 157060343 nonsense probably null
R7216:Soga1 UTSW 2 157018370 missense possibly damaging 0.76
R7335:Soga1 UTSW 2 157031005 missense possibly damaging 0.86
R7562:Soga1 UTSW 2 157053589 missense probably damaging 1.00
R7593:Soga1 UTSW 2 157040856 missense probably benign 0.40
R7788:Soga1 UTSW 2 157027584 missense probably benign 0.09
R8013:Soga1 UTSW 2 157030786 critical splice donor site probably null
R8263:Soga1 UTSW 2 157027590 missense possibly damaging 0.94
R8299:Soga1 UTSW 2 157020731 missense possibly damaging 0.93
X0019:Soga1 UTSW 2 157020264 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCAGCAACTTGTTCTGGTCC -3'
(R):5'- CACCAAGTTGGCTAAGGAGAAC -3'

Sequencing Primer
(F):5'- TGGTCCTCCAGCTCAGC -3'
(R):5'- TTGGCTAAGGAGAACGACAGC -3'
Posted On2016-09-06