Incidental Mutation 'R5369:Rapgef2'
ID429523
Institutional Source Beutler Lab
Gene Symbol Rapgef2
Ensembl Gene ENSMUSG00000062232
Gene NameRap guanine nucleotide exchange factor (GEF) 2
SynonymsCNRasGEF, RA-GEF-1, Pdzgef1, nRapGEP, 5830453M24Rik
MMRRC Submission 042946-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5369 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location79062516-79286517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79069432 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1356 (S1356T)
Ref Sequence ENSEMBL: ENSMUSP00000141542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118100] [ENSMUST00000118340] [ENSMUST00000195708]
Predicted Effect probably benign
Transcript: ENSMUST00000118100
AA Change: S1208T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114119
Gene: ENSMUSG00000062232
AA Change: S1208T

DomainStartEndE-ValueType
low complexity region 38 62 N/A INTRINSIC
low complexity region 84 95 N/A INTRINSIC
cNMP 135 253 2.48e-15 SMART
RasGEFN 267 380 1.3e-31 SMART
PDZ 395 467 1.28e-12 SMART
RA 606 692 7.59e-23 SMART
RasGEF 713 950 6.09e-100 SMART
low complexity region 1030 1046 N/A INTRINSIC
low complexity region 1110 1124 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
low complexity region 1392 1405 N/A INTRINSIC
low complexity region 1440 1455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118340
AA Change: S1206T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113778
Gene: ENSMUSG00000062232
AA Change: S1206T

DomainStartEndE-ValueType
low complexity region 36 60 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
cNMP 133 251 2.48e-15 SMART
RasGEFN 265 378 1.3e-31 SMART
PDZ 393 465 1.28e-12 SMART
RA 604 690 7.59e-23 SMART
RasGEF 711 948 6.09e-100 SMART
low complexity region 1028 1044 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1138 1159 N/A INTRINSIC
low complexity region 1390 1403 N/A INTRINSIC
low complexity region 1438 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195708
AA Change: S1356T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141542
Gene: ENSMUSG00000062232
AA Change: S1356T

DomainStartEndE-ValueType
cNMP 24 131 3.9e-4 SMART
low complexity region 186 210 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
cNMP 283 401 1.2e-17 SMART
RasGEFN 415 528 6.4e-34 SMART
PDZ 543 615 6.4e-15 SMART
RA 754 840 4.8e-25 SMART
RasGEF 861 1098 3.8e-102 SMART
low complexity region 1178 1194 N/A INTRINSIC
low complexity region 1258 1272 N/A INTRINSIC
low complexity region 1288 1309 N/A INTRINSIC
low complexity region 1540 1553 N/A INTRINSIC
low complexity region 1588 1603 N/A INTRINSIC
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF2, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele die at mid-gestation exhibiting growth arrest and defects in vascular development, neural tube closure and embryo turning. Homozygotes for another null allele show yolk sac vascular defects, impaired cell physiology and heart, primitive gut, liver and brain formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T A 6: 41,033,006 R131S probably benign Het
A2ml1 T C 6: 128,568,833 T444A probably damaging Het
A330070K13Rik G A 5: 130,379,091 probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Acbd5 T A 2: 23,112,510 L508Q probably damaging Het
Asb15 T C 6: 24,562,564 V175A probably benign Het
B3galnt2 T C 13: 13,994,425 probably null Het
BC024139 A C 15: 76,120,222 S711R probably benign Het
Bod1l A G 5: 41,827,183 I508T probably damaging Het
Btnl6 T A 17: 34,507,985 R524* probably null Het
C3 C A 17: 57,221,159 D687Y probably benign Het
Ccbe1 G A 18: 66,061,414 A367V probably benign Het
Ccr1 A T 9: 123,964,289 M68K probably damaging Het
Cd27 T A 6: 125,234,364 probably benign Het
Celf2 C A 2: 7,081,081 probably benign Het
Cfap54 T C 10: 93,061,257 probably benign Het
Cfap97 A G 8: 46,169,650 K26E probably damaging Het
Clcn4 T A 7: 7,296,033 I48F probably benign Het
Cnot7 A T 8: 40,494,020 N238K probably benign Het
Colec12 A G 18: 9,866,750 I654V unknown Het
Dip2a A G 10: 76,292,360 I22T probably damaging Het
Eif4g3 C T 4: 138,183,334 T1375M possibly damaging Het
Eml5 C T 12: 98,858,783 G725D probably damaging Het
F12 T C 13: 55,418,491 E496G probably benign Het
Fam227a A T 15: 79,615,436 S573T probably benign Het
Fnip1 T C 11: 54,502,589 V593A probably benign Het
Focad T A 4: 88,121,373 probably benign Het
Frem1 A G 4: 83,001,739 I460T possibly damaging Het
Galnt10 T G 11: 57,765,747 probably null Het
Gm5592 A T 7: 41,218,211 probably benign Het
Gm6185 A T 1: 161,209,760 noncoding transcript Het
Gm7935 A T 15: 74,081,114 noncoding transcript Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Gstm5 G A 3: 107,898,466 A198T probably damaging Het
Herc2 T A 7: 56,182,700 V3048D probably damaging Het
Htra4 T G 8: 25,033,569 I327L possibly damaging Het
Ifi209 T C 1: 173,637,307 M1T probably null Het
Ints6 T C 14: 62,743,935 T135A probably damaging Het
Itpr1 T A 6: 108,519,424 I2604N probably damaging Het
Krt6a T A 15: 101,692,558 M268L probably benign Het
Lrp1b G T 2: 41,004,613 S2201* probably null Het
Lrp2 T C 2: 69,459,560 N3645S probably benign Het
Lrrc15 A T 16: 30,272,904 I539N possibly damaging Het
Map3k6 T C 4: 133,247,681 I675T probably damaging Het
Map3k9 T A 12: 81,722,052 E1074V probably damaging Het
Med13l T A 5: 118,724,010 S339R probably benign Het
Mrps18a T C 17: 46,125,626 probably benign Het
Nat8f2 G T 6: 85,867,872 Y169* probably null Het
Nlrp1b A G 11: 71,181,799 I406T probably benign Het
Npc1l1 A G 11: 6,217,705 probably null Het
Olfr202 A T 16: 59,284,380 M39K probably damaging Het
Olfr419 A G 1: 174,250,441 V162A probably damaging Het
Ostf1 C T 19: 18,581,325 G198E probably benign Het
Pcsk5 A G 19: 17,581,255 V596A probably damaging Het
Pde4c T C 8: 70,750,105 *647Q probably null Het
Pkm A T 9: 59,670,634 I245F probably damaging Het
Ptprj T C 2: 90,469,641 H179R probably benign Het
Rbm45 T A 2: 76,370,250 L41Q probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Scel A T 14: 103,586,493 I386F probably benign Het
Serpinb5 A T 1: 106,881,757 N298Y possibly damaging Het
Sirt3 A T 7: 140,869,493 L180Q probably damaging Het
Slc24a2 C T 4: 86,991,388 V698I probably damaging Het
Slc43a3 A T 2: 84,957,723 H483L probably damaging Het
Snrnp35 A G 5: 124,490,199 D25G probably benign Het
Snrnp40 T C 4: 130,362,646 S55P probably damaging Het
Snx9 T A 17: 5,920,580 C399S probably damaging Het
Soga1 T C 2: 157,040,734 E466G probably damaging Het
Ttbk2 T C 2: 120,825,262 probably benign Het
Vmn1r1 A G 1: 182,157,776 V108A possibly damaging Het
Vmn1r201 T A 13: 22,475,502 N295K probably benign Het
Zfp292 G A 4: 34,807,491 P1851L possibly damaging Het
Zfp472 A T 17: 32,977,743 D264V probably damaging Het
Other mutations in Rapgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rapgef2 APN 3 79092025 missense possibly damaging 0.89
IGL01024:Rapgef2 APN 3 79070138 missense probably benign 0.43
IGL01448:Rapgef2 APN 3 79068937 missense probably benign
IGL01448:Rapgef2 APN 3 79103962 critical splice donor site probably null
IGL01928:Rapgef2 APN 3 79103963 missense probably damaging 1.00
IGL01973:Rapgef2 APN 3 79091809 splice site probably null
IGL02015:Rapgef2 APN 3 79092064 splice site probably benign
IGL02498:Rapgef2 APN 3 79066753 missense probably damaging 0.97
IGL02631:Rapgef2 APN 3 79083226 missense possibly damaging 0.77
IGL02835:Rapgef2 APN 3 79092986 splice site probably benign
IGL02887:Rapgef2 APN 3 79068880 splice site probably benign
IGL03030:Rapgef2 APN 3 79074307 critical splice donor site probably null
IGL03035:Rapgef2 APN 3 79094424 missense probably damaging 1.00
IGL03222:Rapgef2 APN 3 79087995 missense probably damaging 1.00
IGL03227:Rapgef2 APN 3 79092613 splice site probably benign
IGL03326:Rapgef2 APN 3 79091833 missense probably damaging 0.96
IGL03335:Rapgef2 APN 3 79099185 missense probably damaging 1.00
IGL03384:Rapgef2 APN 3 79083546 missense probably damaging 1.00
R0022:Rapgef2 UTSW 3 79087900 missense probably damaging 1.00
R0022:Rapgef2 UTSW 3 79087900 missense probably damaging 1.00
R0038:Rapgef2 UTSW 3 79069396 missense probably benign 0.00
R0117:Rapgef2 UTSW 3 79079177 missense probably benign 0.00
R0225:Rapgef2 UTSW 3 79104105 missense probably damaging 0.99
R0723:Rapgef2 UTSW 3 79079174 missense probably benign 0.20
R0788:Rapgef2 UTSW 3 79099195 missense possibly damaging 0.59
R1311:Rapgef2 UTSW 3 79083547 missense probably benign 0.12
R1374:Rapgef2 UTSW 3 79087968 missense probably benign 0.08
R1507:Rapgef2 UTSW 3 79081293 splice site probably benign
R1523:Rapgef2 UTSW 3 79092749 missense probably damaging 1.00
R1753:Rapgef2 UTSW 3 79088791 missense possibly damaging 0.65
R1759:Rapgef2 UTSW 3 79066731 missense possibly damaging 0.89
R1766:Rapgef2 UTSW 3 79092703 missense probably damaging 1.00
R2436:Rapgef2 UTSW 3 79088772 missense possibly damaging 0.95
R3033:Rapgef2 UTSW 3 79074306 critical splice donor site probably null
R3766:Rapgef2 UTSW 3 79088750 missense probably benign 0.01
R4118:Rapgef2 UTSW 3 79068887 critical splice donor site probably null
R4416:Rapgef2 UTSW 3 79069057 nonsense probably null
R4722:Rapgef2 UTSW 3 79069173 missense probably benign 0.00
R4743:Rapgef2 UTSW 3 79173068 missense probably damaging 0.99
R4780:Rapgef2 UTSW 3 79169769 splice site probably benign
R4825:Rapgef2 UTSW 3 79083227 missense probably benign 0.03
R4861:Rapgef2 UTSW 3 79074436 missense probably benign 0.01
R4861:Rapgef2 UTSW 3 79074436 missense probably benign 0.01
R4900:Rapgef2 UTSW 3 79074363 missense probably benign 0.02
R4943:Rapgef2 UTSW 3 79064547 missense probably benign 0.00
R5291:Rapgef2 UTSW 3 79070059 missense possibly damaging 0.64
R5413:Rapgef2 UTSW 3 79087866 missense probably damaging 1.00
R5561:Rapgef2 UTSW 3 79088643 critical splice donor site probably null
R5568:Rapgef2 UTSW 3 79104001 missense probably damaging 1.00
R5642:Rapgef2 UTSW 3 79094850 missense probably damaging 1.00
R5783:Rapgef2 UTSW 3 79087993 missense probably benign 0.00
R6041:Rapgef2 UTSW 3 79069162 missense probably benign 0.00
R6193:Rapgef2 UTSW 3 79069444 missense possibly damaging 0.48
R6324:Rapgef2 UTSW 3 79079132 missense probably benign 0.01
R6551:Rapgef2 UTSW 3 79215035 splice site probably null
R6688:Rapgef2 UTSW 3 79069128 missense probably benign 0.03
R6908:Rapgef2 UTSW 3 79104063 missense probably benign 0.01
R6913:Rapgef2 UTSW 3 79085974 missense probably damaging 1.00
R6933:Rapgef2 UTSW 3 79085959 missense probably damaging 1.00
R7086:Rapgef2 UTSW 3 79086046 missense probably benign 0.08
R7106:Rapgef2 UTSW 3 79066608 missense probably benign
R7228:Rapgef2 UTSW 3 79069218 missense probably benign 0.03
R7242:Rapgef2 UTSW 3 79087903 nonsense probably null
R7257:Rapgef2 UTSW 3 79082627 missense probably damaging 0.99
R7322:Rapgef2 UTSW 3 79145823 start codon destroyed probably null 0.02
R7443:Rapgef2 UTSW 3 79081224 missense probably damaging 1.00
R7450:Rapgef2 UTSW 3 79173059 missense probably benign 0.01
R7472:Rapgef2 UTSW 3 79069273 missense probably benign 0.45
R7884:Rapgef2 UTSW 3 79066626 missense possibly damaging 0.49
R7967:Rapgef2 UTSW 3 79066626 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CAGCTTCTCTGGTGCTGAATG -3'
(R):5'- TCTCTAGGGTGGAAGAAAGCTGC -3'

Sequencing Primer
(F):5'- AATGGTCTGTATGTTGTCATGGGAAC -3'
(R):5'- AAGATTTGTATAGGCATGGCAGCTC -3'
Posted On2016-09-06