Mutagenetix > Incidental Mutations

Incidental Mutation 'R5398:Csf2rb'

429816

Institutional Source

Beutler Lab

Gene Symbol

Csf2rb

Ensembl Gene

ENSMUSG00000071713

Gene Name

colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)

Synonyms

Csf2rb1, AIC2B, Il5rb, Bc, Il3rb1, beta c, Il3r, common beta chain, CDw131

MMRRC Submission

042969-MU

Accession Numbers

Genbank: NM_007780; MGI: 1339759

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5398 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78325752-78353847 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 78348620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 709 (D709G)

Ref Sequence

ENSEMBL: ENSMUSP00000154836 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096355] [ENSMUST00000229678] [ENSMUST00000230264]

AlphaFold

P26955

Predicted Effect

probably benign
Transcript: ENSMUST00000096355
AA Change: D709G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713
AA Change: D709G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
SCOP:d1gh7a1	29	130	6e-58	SMART
FN3	136	224	4.44e0	SMART
Blast:FN3	245	338	3e-24	BLAST
SCOP:d1gh7a3	245	338	2e-45	SMART
FN3	343	426	2.41e0	SMART
transmembrane domain	446	468	N/A	INTRINSIC
low complexity region	716	743	N/A	INTRINSIC
low complexity region	824	845	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183523

Predicted Effect

probably benign
Transcript: ENSMUST00000229678

Predicted Effect

probably benign
Transcript: ENSMUST00000230264
AA Change: D709G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.4%

Validation Efficiency

95% (59/62)

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit lung pathology including lymphocytic infiltration, alveolar proteinosis-like areas, and increased saturated phosphatidylcholine pool sizes. Mutants also have low peripheral eosinophil numbers. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	A	G	8: 24,872,579	L34P	possibly damaging	Het
Adam34	A	C	8: 43,651,241	C456G	probably damaging	Het
Anapc15	C	T	7: 101,898,603	P68L	probably damaging	Het
Atp8b3	T	C	10: 80,529,699	D407G	probably damaging	Het
Btbd19	G	A	4: 117,123,760	A104V	probably damaging	Het
Chac1	T	G	2: 119,353,244	L109R	possibly damaging	Het
Ddx42	T	A	11: 106,224,898	D112E	probably benign	Het
Dnah5	A	G	15: 28,293,726	K1326E	probably benign	Het
Dnajc3	T	A	14: 118,972,387	Y291*	probably null	Het
Dsg2	T	C	18: 20,579,133	F109L	probably benign	Het
Egfl8	T	C	17: 34,614,639		probably benign	Het
Emb	T	A	13: 117,267,552	I280N	probably damaging	Het
Gcc2	C	A	10: 58,269,507	N188K	probably benign	Het
Gdpd4	A	T	7: 97,971,978	H166L	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Itga11	A	G	9: 62,745,923	T360A	probably benign	Het
Kctd1	A	G	18: 15,062,265	S434P	possibly damaging	Het
Kdm5b	G	A	1: 134,622,098		probably null	Het
Kif24	T	C	4: 41,394,401	E824G	possibly damaging	Het
Lekr1	T	A	3: 65,781,386		noncoding transcript	Het
Ociad1	T	A	5: 73,310,412	V231E	probably benign	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr365	C	A	2: 37,201,318	Q26K	probably benign	Het
Pcdhb1	T	C	18: 37,266,154	L386P	probably damaging	Het
Pcdhb21	G	T	18: 37,515,719	V634L	probably benign	Het
Pcnx2	T	C	8: 125,887,948	K255E	possibly damaging	Het
Pex5l	T	A	3: 32,952,490	I577F	probably damaging	Het
Ppl	A	G	16: 5,104,922	M235T	probably benign	Het
Prl7d1	T	A	13: 27,710,074	I171F	probably damaging	Het
Ptprt	T	C	2: 161,927,592	Y451C	probably damaging	Het
Ranbp17	A	T	11: 33,474,998	Y453N	probably damaging	Het
Rgs16	C	T	1: 153,740,500	T11I	probably benign	Het
Rragb	G	A	X: 153,140,554	G24E	probably damaging	Het
Scn9a	T	C	2: 66,488,043	Y1479C	probably damaging	Het
Slc35f4	T	C	14: 49,298,847	T294A	probably damaging	Het
Slc39a6	A	T	18: 24,597,879	I61N	probably damaging	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Spink12	A	G	18: 44,107,727	D60G	possibly damaging	Het
Sppl2a	T	C	2: 126,919,718	I289V	probably benign	Het
Srebf2	A	G	15: 82,171,242	T176A	probably damaging	Het
Syce1l	T	C	8: 113,652,513	L91S	probably damaging	Het
Tchhl1	T	C	3: 93,471,603	I538T	probably benign	Het
Tcte1	C	T	17: 45,539,826	Q343*	probably null	Het
Tdpoz2	T	G	3: 93,652,134	D177A	probably damaging	Het
Thada	T	G	17: 84,426,186	D1011A	probably benign	Het
Tnn	T	A	1: 160,147,522	M112L	probably benign	Het
Traf1	T	C	2: 34,945,435	E325G	probably damaging	Het
Tyw1	T	C	5: 130,277,157		probably benign	Het
Vmn2r111	C	A	17: 22,573,271	M1I	probably null	Het
Wdr11	C	T	7: 129,631,232	T996M	probably damaging	Het

Other mutations in Csf2rb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Csf2rb	APN	15	78348514	nonsense	probably null
IGL00979:Csf2rb	APN	15	78348104	missense	probably damaging	1.00
IGL01613:Csf2rb	APN	15	78335302	intron	probably benign
IGL01724:Csf2rb	APN	15	78336414	missense	probably damaging	1.00
IGL01942:Csf2rb	APN	15	78340492	missense	probably benign
IGL02479:Csf2rb	APN	15	78341724	nonsense	probably null
3-1:Csf2rb	UTSW	15	78344603	missense	probably damaging	1.00
IGL02802:Csf2rb	UTSW	15	78338903	missense	probably benign	0.00
R0133:Csf2rb	UTSW	15	78339004	unclassified	probably benign
R0179:Csf2rb	UTSW	15	78336372	missense	possibly damaging	0.52
R0487:Csf2rb	UTSW	15	78348331	missense	probably benign	0.00
R1544:Csf2rb	UTSW	15	78340755	missense	probably benign	0.02
R1619:Csf2rb	UTSW	15	78335211	missense	probably damaging	0.99
R1690:Csf2rb	UTSW	15	78348644	missense	probably benign	0.11
R1831:Csf2rb	UTSW	15	78348253	missense	probably benign	0.03
R3970:Csf2rb	UTSW	15	78341467	missense	probably benign
R4922:Csf2rb	UTSW	15	78346467	missense	probably benign	0.02
R5151:Csf2rb	UTSW	15	78340581	missense	probably damaging	1.00
R5202:Csf2rb	UTSW	15	78349057	missense	possibly damaging	0.51
R5496:Csf2rb	UTSW	15	78340561	missense	probably damaging	1.00
R5786:Csf2rb	UTSW	15	78348955	missense	probably damaging	1.00
R6166:Csf2rb	UTSW	15	78344566	missense	probably damaging	1.00
R6347:Csf2rb	UTSW	15	78345552	missense	probably damaging	0.99
R6350:Csf2rb	UTSW	15	78345552	missense	probably damaging	0.99
R6899:Csf2rb	UTSW	15	78340702	missense	probably benign	0.01
R6984:Csf2rb	UTSW	15	78345519	missense	probably damaging	1.00
R7484:Csf2rb	UTSW	15	78338899	missense	possibly damaging	0.53
R7671:Csf2rb	UTSW	15	78338930	missense	probably damaging	1.00
R7751:Csf2rb	UTSW	15	78341639	missense	probably damaging	1.00
R7781:Csf2rb	UTSW	15	78344571	missense	probably benign	0.00
R7861:Csf2rb	UTSW	15	78349157	missense	probably damaging	1.00
R8135:Csf2rb	UTSW	15	78348119	missense	possibly damaging	0.95
R8154:Csf2rb	UTSW	15	78340442	critical splice acceptor site	probably null
R8299:Csf2rb	UTSW	15	78346469	missense	possibly damaging	0.88
R8315:Csf2rb	UTSW	15	78347381	missense	possibly damaging	0.83
R8926:Csf2rb	UTSW	15	78340549	missense	probably benign
R8948:Csf2rb	UTSW	15	78348320	missense	probably benign	0.05
R8950:Csf2rb	UTSW	15	78348320	missense	probably benign	0.05
R9265:Csf2rb	UTSW	15	78348546	missense	probably benign	0.08
X0024:Csf2rb	UTSW	15	78336360	missense	probably damaging	1.00
X0028:Csf2rb	UTSW	15	78349002	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTGGAGTACATGTGTCTGCC -3'
(R):5'- TAGTCCTCAAACCCTGGTGG -3'

Sequencing Primer
(F):5'- AAGCGCAACTGGTTCCATTG -3'
(R):5'- AAACCCTGGTGGCCCTAGAG -3'

Posted On

2016-09-06