Incidental Mutation 'R8948:Csf2rb'
ID 681479
Institutional Source Beutler Lab
Gene Symbol Csf2rb
Ensembl Gene ENSMUSG00000071713
Gene Name colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Synonyms Csf2rb1, AIC2B, Il5rb, Bc, Il3rb1, beta c, Il3r, common beta chain, CDw131
Accession Numbers

Genbank: NM_007780; MGI: 1339759

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8948 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 78325752-78353847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78348320 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 609 (D609V)
Ref Sequence ENSEMBL: ENSMUSP00000154836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096355] [ENSMUST00000229678] [ENSMUST00000230264]
AlphaFold P26955
Predicted Effect probably benign
Transcript: ENSMUST00000096355
AA Change: D609V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713
AA Change: D609V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1gh7a1 29 130 6e-58 SMART
FN3 136 224 4.44e0 SMART
Blast:FN3 245 338 3e-24 BLAST
SCOP:d1gh7a3 245 338 2e-45 SMART
FN3 343 426 2.41e0 SMART
transmembrane domain 446 468 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229678
Predicted Effect probably benign
Transcript: ENSMUST00000230264
AA Change: D609V

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit lung pathology including lymphocytic infiltration, alveolar proteinosis-like areas, and increased saturated phosphatidylcholine pool sizes. Mutants also have low peripheral eosinophil numbers. [provided by MGI curators]
Allele List at MGI

 All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,709,912 S506I probably damaging Het
Abat T C 16: 8,600,941 I102T possibly damaging Het
Abca9 T C 11: 110,163,380 probably null Het
Ago3 T C 4: 126,350,322 probably null Het
Akap1 G T 11: 88,844,273 A75E probably damaging Het
Atad2b C A 12: 4,991,012 A227E possibly damaging Het
Bmpr1a G T 14: 34,441,191 H81N possibly damaging Het
Camkv C T 9: 107,947,097 T236I probably damaging Het
Ccdc30 T C 4: 119,324,161 E601G probably benign Het
Ccin G A 4: 43,984,064 R157H probably damaging Het
Cdkn3 C T 14: 46,767,323 P114L probably damaging Het
Col6a2 C T 10: 76,610,693 G352D probably damaging Het
Ctc1 T G 11: 69,026,349 Y110* probably null Het
D630023F18Rik T A 1: 65,108,740 N218I probably damaging Het
Dchs1 A T 7: 105,759,005 H1873Q probably benign Het
Dnah1 T C 14: 31,290,439 D1901G probably damaging Het
Eddm3b T A 14: 51,116,653 S33T probably damaging Het
Efcc1 A G 6: 87,751,786 T408A probably benign Het
Epas1 A G 17: 86,827,492 T518A probably benign Het
Ergic2 A T 6: 148,202,507 M84K probably damaging Het
Ergic3 T C 2: 156,011,240 V201A probably benign Het
Espn C A 4: 152,138,821 W258L probably damaging Het
Gm45337 A G 7: 142,144,080 S156P unknown Het
Hmcn2 T C 2: 31,354,729 Y733H probably damaging Het
Itga2 C T 13: 114,873,330 G363D probably damaging Het
Kcnk5 T C 14: 20,141,978 R372G probably benign Het
Kif11 T A 19: 37,398,154 D387E probably damaging Het
Lrrn2 A C 1: 132,938,366 I390L probably benign Het
Map2 G T 1: 66,380,525 R5L probably damaging Het
Muc16 C T 9: 18,647,233 R2588K unknown Het
Olfr139 A G 11: 74,044,956 F106S possibly damaging Het
Olfr1451 A T 19: 12,999,081 I32F probably damaging Het
Olfr847 A G 9: 19,374,966 I305T probably benign Het
Osbpl8 T C 10: 111,267,669 I178T probably damaging Het
Perp A T 10: 18,853,578 I86F possibly damaging Het
Plpp1 A T 13: 112,856,977 I149F probably damaging Het
Preb A G 5: 30,958,327 S220P probably damaging Het
Prrt4 T C 6: 29,177,666 T35A probably damaging Het
Ror2 T A 13: 53,131,996 I73F possibly damaging Het
Rpl36-ps4 A G 17: 87,921,146 T40A probably damaging Het
Rsbn1 A T 3: 103,961,514 H623L possibly damaging Het
Sap30 C A 8: 57,487,422 A49S possibly damaging Het
Sf3b3 T C 8: 110,823,443 T648A probably benign Het
Sh3pxd2a T C 19: 47,373,443 R83G probably damaging Het
Slc35e1 A T 8: 72,492,198 I130N probably damaging Het
Smchd1 C T 17: 71,436,772 R466Q probably damaging Het
Smgc C T 15: 91,838,362 probably benign Het
Stk32b A T 5: 37,454,997 N348K possibly damaging Het
Sult2a1 A G 7: 13,796,417 F266L probably damaging Het
Sult2a2 A T 7: 13,733,559 M1L probably damaging Het
Telo2 A G 17: 25,113,111 V161A probably benign Het
Tmed11 C T 5: 108,777,427 R173H probably damaging Het
Trappc6a G A 7: 19,515,998 probably benign Het
Twistnb T A 12: 33,433,527 Y93N probably damaging Het
Vmn2r5 A T 3: 64,491,101 V819D probably damaging Het
Vmn2r74 A G 7: 85,957,361 I259T probably damaging Het
Vps13a A G 19: 16,745,976 I286T probably damaging Het
Vsig10l A T 7: 43,468,199 I739F possibly damaging Het
Zfyve1 A C 12: 83,548,028 V730G probably benign Het
Zfyve9 A T 4: 108,642,091 D1284E possibly damaging Het
Zmym4 C T 4: 126,864,267 R1498H probably damaging Het
Znhit2 A T 19: 6,061,773 R183* probably null Het
Other mutations in Csf2rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Csf2rb APN 15 78348514 nonsense probably null
IGL00979:Csf2rb APN 15 78348104 missense probably damaging 1.00
IGL01613:Csf2rb APN 15 78335302 intron probably benign
IGL01724:Csf2rb APN 15 78336414 missense probably damaging 1.00
IGL01942:Csf2rb APN 15 78340492 missense probably benign
IGL02479:Csf2rb APN 15 78341724 nonsense probably null
3-1:Csf2rb UTSW 15 78344603 missense probably damaging 1.00
IGL02802:Csf2rb UTSW 15 78338903 missense probably benign 0.00
R0133:Csf2rb UTSW 15 78339004 unclassified probably benign
R0179:Csf2rb UTSW 15 78336372 missense possibly damaging 0.52
R0487:Csf2rb UTSW 15 78348331 missense probably benign 0.00
R1544:Csf2rb UTSW 15 78340755 missense probably benign 0.02
R1619:Csf2rb UTSW 15 78335211 missense probably damaging 0.99
R1690:Csf2rb UTSW 15 78348644 missense probably benign 0.11
R1831:Csf2rb UTSW 15 78348253 missense probably benign 0.03
R3970:Csf2rb UTSW 15 78341467 missense probably benign
R4922:Csf2rb UTSW 15 78346467 missense probably benign 0.02
R5151:Csf2rb UTSW 15 78340581 missense probably damaging 1.00
R5202:Csf2rb UTSW 15 78349057 missense possibly damaging 0.51
R5398:Csf2rb UTSW 15 78348620 missense probably benign
R5496:Csf2rb UTSW 15 78340561 missense probably damaging 1.00
R5786:Csf2rb UTSW 15 78348955 missense probably damaging 1.00
R6166:Csf2rb UTSW 15 78344566 missense probably damaging 1.00
R6347:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6350:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6899:Csf2rb UTSW 15 78340702 missense probably benign 0.01
R6984:Csf2rb UTSW 15 78345519 missense probably damaging 1.00
R7484:Csf2rb UTSW 15 78338899 missense possibly damaging 0.53
R7671:Csf2rb UTSW 15 78338930 missense probably damaging 1.00
R7751:Csf2rb UTSW 15 78341639 missense probably damaging 1.00
R7781:Csf2rb UTSW 15 78344571 missense probably benign 0.00
R7861:Csf2rb UTSW 15 78349157 missense probably damaging 1.00
R8135:Csf2rb UTSW 15 78348119 missense possibly damaging 0.95
R8154:Csf2rb UTSW 15 78340442 critical splice acceptor site probably null
R8299:Csf2rb UTSW 15 78346469 missense possibly damaging 0.88
R8315:Csf2rb UTSW 15 78347381 missense possibly damaging 0.83
R8926:Csf2rb UTSW 15 78340549 missense probably benign
R8950:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R9265:Csf2rb UTSW 15 78348546 missense probably benign 0.08
X0024:Csf2rb UTSW 15 78336360 missense probably damaging 1.00
X0028:Csf2rb UTSW 15 78349002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTGTCACCTCTCACTATAGAG -3'
(R):5'- TCCTTTGGCTCCACAGAAGG -3'

Sequencing Primer
(F):5'- ATATAATTCGAGTTCCACCATCCGGG -3'
(R):5'- TCCACAGAAGGGCTCCC -3'
Posted On 2021-08-31