Incidental Mutation 'R5399:G2e3'
ID429894
Institutional Source Beutler Lab
Gene Symbol G2e3
Ensembl Gene ENSMUSG00000035293
Gene NameG2/M-phase specific E3 ubiquitin ligase
Synonyms6030408C04Rik, D930034K21Rik
MMRRC Submission 042970-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.616) question?
Stock #R5399 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location51348061-51376986 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 51357194 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054308] [ENSMUST00000119211] [ENSMUST00000121521]
Predicted Effect probably null
Transcript: ENSMUST00000054308
SMART Domains Protein: ENSMUSP00000054474
Gene: ENSMUSG00000035293

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 1e-2 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 402 692 2.7e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119211
SMART Domains Protein: ENSMUSP00000113270
Gene: ENSMUSG00000035293

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 9e-3 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 383 717 3.1e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121521
SMART Domains Protein: ENSMUSP00000113191
Gene: ENSMUSG00000035293

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 9e-3 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 298 598 4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144767
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele that inactivates this gene die prior to implantation due to massive apoptosis which results in involution of the blastocyst. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik G T 2: 152,440,868 L214F probably damaging Het
Abcb1b T C 5: 8,827,410 S657P probably benign Het
Abcb5 T A 12: 118,911,499 Y646F probably benign Het
Agl A T 3: 116,781,628 L620Q probably damaging Het
Anapc15 C T 7: 101,898,603 P68L probably damaging Het
Arhgap23 A G 11: 97,500,917 N1420S probably damaging Het
Arntl2 T G 6: 146,822,661 D350E probably damaging Het
Barx2 A G 9: 31,854,111 probably null Het
Birc6 C A 17: 74,604,578 S28R possibly damaging Het
Btbd19 G A 4: 117,123,760 A104V probably damaging Het
Casp4 A T 9: 5,324,928 K247* probably null Het
Clk4 T C 11: 51,275,257 Y17H probably damaging Het
Cntnap1 A G 11: 101,183,316 Q722R probably benign Het
Col6a6 A G 9: 105,709,107 V1905A possibly damaging Het
Csmd1 C A 8: 16,710,597 G174V probably damaging Het
Cul1 T A 6: 47,485,084 probably null Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Dnaaf2 A G 12: 69,196,742 I515T probably damaging Het
Fbn1 T C 2: 125,332,333 I1868V possibly damaging Het
Fcgbp G T 7: 28,105,055 V1863L probably benign Het
Gabrr2 T C 4: 33,071,458 probably null Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gbgt1 C T 2: 28,503,218 P106L probably damaging Het
Gm13023 T C 4: 143,795,032 F406S probably benign Het
Gm6657 A C 12: 78,197,453 N60T probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,205,024 E927G probably damaging Het
Hfm1 T A 5: 106,917,562 I84F possibly damaging Het
Htt G T 5: 34,877,151 D1989Y probably damaging Het
Ihh C T 1: 74,946,277 A350T probably benign Het
Irx4 G C 13: 73,265,539 A43P probably benign Het
Itk A G 11: 46,338,111 V414A probably benign Het
Itsn2 A T 12: 4,653,535 I744L probably benign Het
Kdm5b G A 1: 134,622,098 probably null Het
Kif14 A G 1: 136,503,324 D1153G probably benign Het
Morc3 A G 16: 93,862,539 probably null Het
Msc A T 1: 14,755,556 C65S probably benign Het
Mybpc1 A G 10: 88,523,014 V343A probably damaging Het
Myo5c T C 9: 75,288,074 I1218T possibly damaging Het
Mypn C T 10: 63,120,186 V1163I probably benign Het
Obox3 A T 7: 15,626,288 M152K probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1204 T A 2: 88,852,655 L235H probably damaging Het
Olfr1264 T A 2: 90,021,923 T48S probably benign Het
Olfr328 A G 11: 58,552,143 V32A probably benign Het
Pcdhb21 G T 18: 37,515,719 V634L probably benign Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prss23 A T 7: 89,509,966 D298E probably benign Het
Rab4b A T 7: 27,176,162 N31K probably benign Het
Ros1 A G 10: 52,090,944 probably null Het
Rragb G A X: 153,140,554 G24E probably damaging Het
Rtl1 A T 12: 109,590,302 L1701Q probably damaging Het
Sbno1 T A 5: 124,392,741 N831Y probably benign Het
Selp A G 1: 164,126,586 K152E possibly damaging Het
Sema4b A G 7: 80,224,886 T675A probably benign Het
Slc36a3 T C 11: 55,146,180 I100V possibly damaging Het
Slco1a4 T A 6: 141,830,707 I196F probably damaging Het
Spata13 G A 14: 60,747,541 S828N probably benign Het
Stard13 A T 5: 151,047,801 Y643* probably null Het
Tll1 T C 8: 64,085,488 H374R probably damaging Het
Trmt10a T A 3: 138,147,504 I42K probably damaging Het
Trmu A T 15: 85,896,408 probably null Het
Trp53 T A 11: 69,588,546 D183E probably benign Het
Ttc22 T G 4: 106,636,757 F305V probably damaging Het
Unc13c A G 9: 73,749,688 F1077S possibly damaging Het
Utrn T A 10: 12,640,983 Q2289L probably damaging Het
Vmn1r65 C A 7: 6,008,810 E142* probably null Het
Vmn2r63 A T 7: 42,928,277 V279D probably benign Het
Zfp810 G A 9: 22,278,829 T261I possibly damaging Het
Zkscan17 A G 11: 59,502,918 probably null Het
Other mutations in G2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:G2e3 APN 12 51353798 critical splice acceptor site probably null
IGL00793:G2e3 APN 12 51367762 missense probably benign 0.00
IGL02222:G2e3 APN 12 51363233 missense probably damaging 1.00
IGL02335:G2e3 APN 12 51369158 missense probably benign 0.19
IGL03134:G2e3 APN 12 51364030 intron probably benign
Amadeus UTSW 12 51353789 splice site probably null
R1868:G2e3 UTSW 12 51353629 missense probably benign 0.44
R2060:G2e3 UTSW 12 51372606 missense probably damaging 1.00
R3814:G2e3 UTSW 12 51353661 missense probably benign 0.28
R4355:G2e3 UTSW 12 51365337 missense probably benign 0.00
R4360:G2e3 UTSW 12 51363414 splice site probably benign
R4903:G2e3 UTSW 12 51371630 missense probably benign 0.23
R4966:G2e3 UTSW 12 51371630 missense probably benign 0.23
R4974:G2e3 UTSW 12 51369139 missense probably benign 0.00
R5406:G2e3 UTSW 12 51372666 missense probably damaging 0.97
R5739:G2e3 UTSW 12 51372504 missense possibly damaging 0.94
R6225:G2e3 UTSW 12 51369136 missense possibly damaging 0.77
R6625:G2e3 UTSW 12 51353789 splice site probably null
R7458:G2e3 UTSW 12 51365507 missense possibly damaging 0.67
R7529:G2e3 UTSW 12 51371604 missense probably damaging 1.00
R7713:G2e3 UTSW 12 51369056 missense probably damaging 0.99
R7748:G2e3 UTSW 12 51371667 missense probably benign 0.00
R7998:G2e3 UTSW 12 51353841 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGGTCATTTTGCTGGAAACATCG -3'
(R):5'- TCAGTGAGTATTAATCCAAGGGG -3'

Sequencing Primer
(F):5'- ATTTTGCTGGAAACATCGACCCG -3'
(R):5'- GAGCCGACCTCTGATTTTTAGGATAC -3'
Posted On2016-09-06