Incidental Mutation 'R5497:Atp2a2'
ID432404
Institutional Source Beutler Lab
Gene Symbol Atp2a2
Ensembl Gene ENSMUSG00000029467
Gene NameATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Synonyms9530097L16Rik, SERCA2, D5Wsu150e, SERCA2B, sarco/endoplasmic reticulum Ca2+-ATPase 2
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5497 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location122453513-122502225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122458169 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 887 (C887Y)
Ref Sequence ENSEMBL: ENSMUSP00000135935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031423] [ENSMUST00000177974] [ENSMUST00000179939]
Predicted Effect probably damaging
Transcript: ENSMUST00000031423
AA Change: C887Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031423
Gene: ENSMUSG00000029467
AA Change: C887Y

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 92 340 2.1e-66 PFAM
Pfam:Hydrolase 345 714 1.2e-18 PFAM
Pfam:HAD 348 711 1e-18 PFAM
Pfam:Cation_ATPase 418 527 2.5e-24 PFAM
Pfam:Hydrolase_3 682 746 1.9e-7 PFAM
Pfam:Cation_ATPase_C 783 986 2.4e-48 PFAM
transmembrane domain 1015 1032 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177974
AA Change: C887Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136104
Gene: ENSMUSG00000029467
AA Change: C887Y

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 92 340 5.1e-66 PFAM
Pfam:Hydrolase 345 714 2.7e-18 PFAM
Pfam:HAD 348 711 2.6e-18 PFAM
Pfam:Cation_ATPase 418 527 4.7e-24 PFAM
Pfam:Hydrolase_3 682 746 7.2e-7 PFAM
Pfam:Cation_ATPase_C 783 986 5.9e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179939
AA Change: C887Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135935
Gene: ENSMUSG00000029467
AA Change: C887Y

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 93 341 9e-69 PFAM
Pfam:HAD 348 711 1.2e-16 PFAM
Pfam:Hydrolase_like2 418 527 3.1e-24 PFAM
Pfam:Hydrolase 496 714 8.7e-24 PFAM
Pfam:Hydrolase_3 682 746 3.4e-7 PFAM
Pfam:Cation_ATPase_C 783 986 1.6e-47 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the sarcoplasmic reticulum lumen, and is involved in regulation of the contraction/relaxation cycle. Mutations in this gene cause Darier-White disease, also known as keratosis follicularis, an autosomal dominant skin disorder characterized by loss of adhesion between epidermal cells and abnormal keratinization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Targeted homozygous mutants are embryonic lethal while heterozygotes show reduced blood pressure and mildly impaired cardiac contractility and relaxation. Aged heterozygotes for one targeted mutation develop squamous cell tumors of the forestomach, esophagus, oral mucosa, tongue, and skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Adarb1 T C 10: 77,325,889 D2G probably damaging Het
Apaf1 G A 10: 90,999,656 A1098V probably damaging Het
Asap3 A G 4: 136,239,222 H537R probably benign Het
Atp6v0a1 G A 11: 101,029,185 V215M probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Cebpe A G 14: 54,710,595 F264L probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Eif3e T C 15: 43,270,970 Y127C probably damaging Het
Fam160b1 G C 19: 57,381,151 probably null Het
Galnt5 T C 2: 58,025,328 M632T probably damaging Het
Gja8 A G 3: 96,920,197 S50P probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Hsd3b7 A G 7: 127,801,888 Y99C probably damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Olfr169 C T 16: 19,566,330 M184I probably benign Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Srm G T 4: 148,594,109 Q264H probably benign Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp980 A G 4: 145,701,447 K249E probably damaging Het
Other mutations in Atp2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Atp2a2 APN 5 122458083 splice site probably null
IGL01459:Atp2a2 APN 5 122469652 missense probably benign 0.03
IGL01721:Atp2a2 APN 5 122500792 missense possibly damaging 0.89
IGL02614:Atp2a2 APN 5 122489303 missense probably benign 0.00
IGL02616:Atp2a2 APN 5 122461684 missense probably benign 0.07
IGL02826:Atp2a2 APN 5 122489291 missense probably benign 0.03
IGL02876:Atp2a2 APN 5 122466008 missense probably benign 0.18
PIT4458001:Atp2a2 UTSW 5 122457309 nonsense probably null
R0087:Atp2a2 UTSW 5 122460961 missense probably benign 0.02
R0139:Atp2a2 UTSW 5 122491715 missense probably damaging 1.00
R0166:Atp2a2 UTSW 5 122466838 missense possibly damaging 0.69
R0457:Atp2a2 UTSW 5 122469714 missense probably benign
R0658:Atp2a2 UTSW 5 122457633 splice site probably benign
R0815:Atp2a2 UTSW 5 122471236 missense probably benign 0.02
R1282:Atp2a2 UTSW 5 122491754 missense probably benign 0.00
R1538:Atp2a2 UTSW 5 122457377 missense probably damaging 1.00
R1985:Atp2a2 UTSW 5 122466836 missense probably benign 0.03
R2111:Atp2a2 UTSW 5 122459546 missense probably damaging 1.00
R2517:Atp2a2 UTSW 5 122457513 missense probably damaging 0.99
R4225:Atp2a2 UTSW 5 122469726 missense probably benign
R4473:Atp2a2 UTSW 5 122457264 missense probably benign 0.01
R4956:Atp2a2 UTSW 5 122461580 missense probably benign 0.02
R4969:Atp2a2 UTSW 5 122458491 missense possibly damaging 0.95
R5242:Atp2a2 UTSW 5 122461946 missense probably damaging 1.00
R5307:Atp2a2 UTSW 5 122461747 missense probably benign 0.06
R5536:Atp2a2 UTSW 5 122457182 missense probably benign 0.05
R5629:Atp2a2 UTSW 5 122460096 missense probably damaging 1.00
R5641:Atp2a2 UTSW 5 122457576 missense probably damaging 1.00
R6365:Atp2a2 UTSW 5 122461916 missense probably benign 0.20
R6383:Atp2a2 UTSW 5 122501649 missense probably benign 0.37
R6534:Atp2a2 UTSW 5 122457198 missense possibly damaging 0.73
R7162:Atp2a2 UTSW 5 122489324 missense probably benign 0.00
R7259:Atp2a2 UTSW 5 122466069 missense probably benign 0.27
R7268:Atp2a2 UTSW 5 122467729 missense probably benign 0.00
R7465:Atp2a2 UTSW 5 122461700 missense probably benign
R7489:Atp2a2 UTSW 5 122467767 missense probably benign
R7567:Atp2a2 UTSW 5 122491784 missense probably benign 0.29
R7729:Atp2a2 UTSW 5 122491766 missense probably benign 0.30
R7734:Atp2a2 UTSW 5 122458527 missense possibly damaging 0.95
R7739:Atp2a2 UTSW 5 122469705 missense probably damaging 0.98
R7743:Atp2a2 UTSW 5 122461571 missense probably benign 0.32
R7934:Atp2a2 UTSW 5 122461576 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATCAGGAACCCATGATGG -3'
(R):5'- AGGTAGCTCTAAGACCCAGG -3'

Sequencing Primer
(F):5'- CCACTGTTTCCTGGGGAACAATAG -3'
(R):5'- TCTAAGACCCAGGGCTTCTG -3'
Posted On2016-10-05