Incidental Mutation 'R5497:Olfr169'
ID432442
Institutional Source Beutler Lab
Gene Symbol Olfr169
Ensembl Gene ENSMUSG00000068535
Gene Nameolfactory receptor 169
SynonymsGA_x54KRFPKG5P-16014972-16014031, MOR273-3P
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5497 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location19564889-19571809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19566330 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 184 (M184I)
Ref Sequence ENSEMBL: ENSMUSP00000150528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090062] [ENSMUST00000215040] [ENSMUST00000215476] [ENSMUST00000216070]
Predicted Effect probably benign
Transcript: ENSMUST00000090062
AA Change: M184I

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000087516
Gene: ENSMUSG00000068535
AA Change: M184I

DomainStartEndE-ValueType
Pfam:7tm_4 28 308 1.3e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 303 2e-6 PFAM
Pfam:7tm_1 41 290 7.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215040
AA Change: M184I

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000215476
AA Change: M184I

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216070
AA Change: M184I

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Adarb1 T C 10: 77,325,889 D2G probably damaging Het
Apaf1 G A 10: 90,999,656 A1098V probably damaging Het
Asap3 A G 4: 136,239,222 H537R probably benign Het
Atp2a2 C T 5: 122,458,169 C887Y probably damaging Het
Atp6v0a1 G A 11: 101,029,185 V215M probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Cebpe A G 14: 54,710,595 F264L probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Eif3e T C 15: 43,270,970 Y127C probably damaging Het
Fam160b1 G C 19: 57,381,151 probably null Het
Galnt5 T C 2: 58,025,328 M632T probably damaging Het
Gja8 A G 3: 96,920,197 S50P probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Hsd3b7 A G 7: 127,801,888 Y99C probably damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Srm G T 4: 148,594,109 Q264H probably benign Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp980 A G 4: 145,701,447 K249E probably damaging Het
Other mutations in Olfr169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Olfr169 APN 16 19566208 missense probably damaging 1.00
IGL01862:Olfr169 APN 16 19566676 missense probably damaging 1.00
IGL02064:Olfr169 APN 16 19566548 missense probably damaging 1.00
IGL03061:Olfr169 APN 16 19566713 missense possibly damaging 0.87
IGL03136:Olfr169 APN 16 19566353 missense probably damaging 1.00
R0066:Olfr169 UTSW 16 19566049 missense probably damaging 1.00
R0243:Olfr169 UTSW 16 19566294 missense probably damaging 0.97
R0629:Olfr169 UTSW 16 19565980 missense possibly damaging 0.88
R1644:Olfr169 UTSW 16 19566406 missense probably benign 0.11
R1943:Olfr169 UTSW 16 19566437 missense probably benign 0.19
R3016:Olfr169 UTSW 16 19566391 missense probably damaging 1.00
R4290:Olfr169 UTSW 16 19566244 missense possibly damaging 0.88
R4689:Olfr169 UTSW 16 19566513 nonsense probably null
R4791:Olfr169 UTSW 16 19566663 missense possibly damaging 0.50
R5843:Olfr169 UTSW 16 19566583 missense probably damaging 1.00
R6106:Olfr169 UTSW 16 19566259 missense probably damaging 0.99
R6249:Olfr169 UTSW 16 19565975 missense probably damaging 0.99
R7895:Olfr169 UTSW 16 19566722 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCCATAGTACATTATGACAAC -3'
(R):5'- GATCGATATGTGGCCATCTGC -3'

Sequencing Primer
(F):5'- GTACATTATGACAACAACCATGTGG -3'
(R):5'- GCCACCCACTTCGCTAC -3'
Posted On2016-10-05