Incidental Mutation 'R5596:Tnfrsf9'
ID437823
Institutional Source Beutler Lab
Gene Symbol Tnfrsf9
Ensembl Gene ENSMUSG00000028965
Gene Nametumor necrosis factor receptor superfamily, member 9
SynonymsA930040I11Rik, Cd137, Ly63, ILA, CDw137, 4-1BB
MMRRC Submission 043148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5596 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location150914562-150946102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150929874 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 10 (V10A)
Ref Sequence ENSEMBL: ENSMUSP00000111961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030808] [ENSMUST00000060901] [ENSMUST00000105671] [ENSMUST00000105672] [ENSMUST00000116257] [ENSMUST00000126707] [ENSMUST00000135169] [ENSMUST00000139826] [ENSMUST00000169423]
Predicted Effect probably benign
Transcript: ENSMUST00000030808
AA Change: V10A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000030808
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060901
AA Change: V10A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000059684
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 1.1e-8 SMART
TNFR 119 158 5.4e-5 SMART
low complexity region 201 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105671
AA Change: V10A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101296
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105672
AA Change: V10A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101297
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 1.1e-8 SMART
TNFR 119 158 5.4e-5 SMART
low complexity region 201 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116257
AA Change: V10A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000111961
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126707
AA Change: V10A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000122917
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135169
AA Change: V10A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000120761
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139826
AA Change: V10A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000117860
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146133
Predicted Effect probably benign
Transcript: ENSMUST00000169423
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contributes to the clonal expansion, survival, and development of T cells. It can also induce proliferation in peripheral monocytes, enhance T cell apoptosis induced by TCR/CD3 triggered activation, and regulate CD28 co-stimulation to promote Th1 cell responses. The expression of this receptor is induced by lymphocyte activation. TRAF adaptor proteins have been shown to bind to this receptor and transduce the signals leading to activation of NF-kappaB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in enhanced T cell proliferation, decreased B cell IgG production, decreased cytotoxic T cell activity, and increased numbers of erythrocytes, granulocyte macrophages, and multipotential progenitor cells in the bone marrow, blood, and spleen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,401,749 M1503V possibly damaging Het
Abraxas1 A T 5: 100,818,537 V53D probably damaging Het
Bub1b T C 2: 118,630,982 S672P probably damaging Het
C1qtnf7 A T 5: 43,515,970 probably benign Het
C87499 C T 4: 88,630,055 E38K probably damaging Het
Cacng7 A T 7: 3,366,904 I262F probably benign Het
Capzb T G 4: 139,279,427 probably benign Het
Ccdc149 A G 5: 52,404,151 V229A probably damaging Het
Cfap69 A G 5: 5,626,020 L225P probably damaging Het
Cftr A G 6: 18,268,096 T685A probably benign Het
Col12a1 G A 9: 79,703,759 T177M probably damaging Het
Creb3l3 T G 10: 81,085,047 D383A probably benign Het
Cyp2j8 T A 4: 96,507,341 I16F probably benign Het
Dnah5 G T 15: 28,343,608 A2385S probably damaging Het
Enox1 A G 14: 77,579,053 I158V probably benign Het
Erich3 A T 3: 154,727,396 T139S probably damaging Het
Fam186b A T 15: 99,271,289 S926T possibly damaging Het
Gjd2 C A 2: 114,011,484 V171F possibly damaging Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Helz2 A T 2: 181,237,289 probably benign Het
Herc1 T TTN 9: 66,434,063 probably benign Het
Impg1 A T 9: 80,345,218 V483E probably benign Het
Irx4 A G 13: 73,267,680 N196S probably damaging Het
Kcnip1 T C 11: 33,630,597 D213G probably damaging Het
Lmntd1 T A 6: 145,413,414 T191S probably benign Het
Med12l T A 3: 59,252,350 N1273K probably benign Het
Musk T C 4: 58,373,036 C654R probably damaging Het
Nlrp4d A T 7: 10,382,024 S274T noncoding transcript Het
Omd A G 13: 49,592,338 H408R probably benign Het
Pbld2 C T 10: 63,072,012 A219V probably damaging Het
Ptpn1 T C 2: 167,974,763 I246T probably damaging Het
Sap18b G T 8: 95,825,370 A3S unknown Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Sstr4 G T 2: 148,395,732 V88F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tmcc2 T C 1: 132,360,483 N489D probably damaging Het
Tnxb T A 17: 34,688,804 V1274E probably damaging Het
Ube3b T A 5: 114,406,160 probably null Het
Vwa5a A T 9: 38,722,578 I26F probably damaging Het
Other mutations in Tnfrsf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
asilomar UTSW 4 150929874 missense probably benign 0.01
FR4304:Tnfrsf9 UTSW 4 150934395 intron probably benign
FR4342:Tnfrsf9 UTSW 4 150934394 intron probably benign
R1496:Tnfrsf9 UTSW 4 150933104 critical splice donor site probably null
R1870:Tnfrsf9 UTSW 4 150934347 nonsense probably null
R7219:Tnfrsf9 UTSW 4 150935534 missense probably damaging 1.00
R7322:Tnfrsf9 UTSW 4 150934337 missense probably damaging 1.00
R7440:Tnfrsf9 UTSW 4 150929874 missense probably benign 0.01
R7680:Tnfrsf9 UTSW 4 150929938 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGACACTTGTGAGATATCCC -3'
(R):5'- GGCTGCTTTGTTGGATTCAA -3'

Sequencing Primer
(F):5'- TGGGGTTACAGCATCCACTAC -3'
(R):5'- AGTCGGTGCTCTTAACCAAAGTC -3'
Posted On2016-10-26