Incidental Mutation 'R5598:Tmco4'
ID437915
Institutional Source Beutler Lab
Gene Symbol Tmco4
Ensembl Gene ENSMUSG00000041143
Gene Nametransmembrane and coiled-coil domains 4
Synonyms4632413C14Rik
MMRRC Submission 043150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5598 (G1)
Quality Score93
Status Not validated
Chromosome4
Chromosomal Location138972888-139059171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139053905 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 460 (D460G)
Ref Sequence ENSEMBL: ENSMUSP00000059320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043042] [ENSMUST00000050949]
Predicted Effect probably damaging
Transcript: ENSMUST00000043042
AA Change: D460G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041388
Gene: ENSMUSG00000041143
AA Change: D460G

DomainStartEndE-ValueType
Pfam:DUF726 182 518 1.1e-138 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000050949
AA Change: D460G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059320
Gene: ENSMUSG00000041143
AA Change: D460G

DomainStartEndE-ValueType
Pfam:DUF726 182 518 5.3e-145 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,183,725 D550G probably damaging Het
Ano6 A G 15: 95,941,347 T457A probably damaging Het
Ano8 A G 8: 71,482,577 V359A probably damaging Het
Aqp2 G T 15: 99,579,112 probably benign Het
Atp13a5 C T 16: 29,257,077 probably benign Het
Carmil3 ACCCCC ACCCCCCCCCCCC 14: 55,503,999 probably null Het
Ccr1l1 A G 9: 123,977,993 V139A probably benign Het
Cecr2 A G 6: 120,731,446 probably null Het
Celsr2 A G 3: 108,402,803 V1537A possibly damaging Het
Chd6 T A 2: 161,014,112 K741N probably damaging Het
Chrna1 T A 2: 73,566,731 T405S probably benign Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Cmss1 C A 16: 57,311,286 C159F probably damaging Het
Col1a2 A G 6: 4,516,916 probably benign Het
Cradd G T 10: 95,175,804 S158* probably null Het
Dmxl1 G A 18: 49,864,478 A578T probably benign Het
Drd2 A G 9: 49,407,015 N419S possibly damaging Het
E4f1 T C 17: 24,447,129 T232A probably damaging Het
Fat2 T A 11: 55,281,130 E2919V probably damaging Het
Gc T C 5: 89,438,450 probably null Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hsd11b2 G A 8: 105,522,511 V173I probably benign Het
Kdm6b C T 11: 69,406,074 A456T probably damaging Het
Kif18b G A 11: 102,908,189 P729S possibly damaging Het
Lgi1 A G 19: 38,306,181 D467G possibly damaging Het
Loxl1 A G 9: 58,312,367 Y174H possibly damaging Het
Mtus1 A T 8: 41,022,555 I824N probably damaging Het
Myrf C T 19: 10,215,290 E622K probably benign Het
Ncam1 A G 9: 49,545,751 Y416H probably damaging Het
Nceh1 A G 3: 27,226,099 T132A probably benign Het
Nhlrc4 G A 17: 25,943,492 P94S probably damaging Het
Olfr56 C G 11: 49,135,114 D307E probably benign Het
Olfr591 A T 7: 103,173,634 M1K probably null Het
Olfr906 A T 9: 38,488,525 R165S possibly damaging Het
Pcdhac2 A G 18: 37,144,423 Y152C probably damaging Het
Pdia3 C A 2: 121,414,130 T8K possibly damaging Het
Pogz T A 3: 94,864,509 V304E probably damaging Het
Snrnp200 A G 2: 127,226,087 S835G possibly damaging Het
Susd4 T C 1: 182,892,070 S417P probably benign Het
Thsd7b G A 1: 129,595,841 R127H probably damaging Het
Ttll9 T A 2: 152,984,314 M148K probably damaging Het
Ubn2 G A 6: 38,490,388 C677Y probably benign Het
Vmn2r98 T C 17: 19,080,899 I721T probably benign Het
Wdfy4 C A 14: 33,133,497 C720F probably damaging Het
Zzef1 G A 11: 72,916,521 D2742N probably damaging Het
Other mutations in Tmco4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00741:Tmco4 APN 4 138996574 critical splice donor site probably null
IGL01346:Tmco4 APN 4 139020949 missense probably damaging 0.97
IGL02552:Tmco4 APN 4 139058379 missense probably benign 0.00
IGL02644:Tmco4 APN 4 139010609 splice site probably benign
IGL02676:Tmco4 APN 4 139023069 critical splice donor site probably null
IGL02741:Tmco4 APN 4 139029877 missense probably damaging 1.00
R0116:Tmco4 UTSW 4 139053920 missense probably damaging 1.00
R0611:Tmco4 UTSW 4 139020072 missense probably damaging 1.00
R4034:Tmco4 UTSW 4 139020861 missense probably damaging 1.00
R4612:Tmco4 UTSW 4 138990560 missense probably benign
R4785:Tmco4 UTSW 4 138998039 missense probably damaging 0.97
R4981:Tmco4 UTSW 4 138990701 missense possibly damaging 0.63
R5040:Tmco4 UTSW 4 139020166 missense probably damaging 1.00
R5052:Tmco4 UTSW 4 139058506 missense probably benign
R5074:Tmco4 UTSW 4 139058122 missense probably damaging 0.98
R5364:Tmco4 UTSW 4 139052504 missense probably damaging 0.99
R5445:Tmco4 UTSW 4 139020867 missense probably damaging 1.00
R6959:Tmco4 UTSW 4 139010499 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCCTGAGAGCATCTAGAGAC -3'
(R):5'- TCGCAAGAGGCAGGTATGTG -3'

Sequencing Primer
(F):5'- TGAGAGCATCTAGAGACCACTC -3'
(R):5'- GTATGTGCAGGTACCATCTCCAAG -3'
Posted On2016-10-26