Mutagenetix > Incidental Mutation

Incidental Mutation 'R5598:Vmn2r98'

437944

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r98

Ensembl Gene

ENSMUSG00000096717

Gene Name

vomeronasal 2, receptor 98

Synonyms

EG224552

MMRRC Submission

043150-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R5598 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19053460-19082411 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19080899 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 721 (I721T)

Ref Sequence

ENSEMBL: ENSMUSP00000131261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170424]

AlphaFold

E9PZ56

Predicted Effect

probably benign
Transcript: ENSMUST00000170424
AA Change: I721T

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: I721T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	460	2.6e-35	PFAM
Pfam:NCD3G	509	562	7.4e-22	PFAM
Pfam:7tm_3	594	830	1.4e-52	PFAM
low complexity region	844	856	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adnp	T	C	2: 168,183,725	D550G	probably damaging	Het
Ano6	A	G	15: 95,941,347	T457A	probably damaging	Het
Ano8	A	G	8: 71,482,577	V359A	probably damaging	Het
Aqp2	G	T	15: 99,579,112		probably benign	Het
Atp13a5	C	T	16: 29,257,077		probably benign	Het
Carmil3	ACCCCC	ACCCCCCCCCCCC	14: 55,503,999		probably null	Het
Ccr1l1	A	G	9: 123,977,993	V139A	probably benign	Het
Cecr2	A	G	6: 120,731,446		probably null	Het
Celsr2	A	G	3: 108,402,803	V1537A	possibly damaging	Het
Chd6	T	A	2: 161,014,112	K741N	probably damaging	Het
Chrna1	T	A	2: 73,566,731	T405S	probably benign	Het
Cish	T	C	9: 107,297,028	V5A	possibly damaging	Het
Cmss1	C	A	16: 57,311,286	C159F	probably damaging	Het
Col1a2	A	G	6: 4,516,916		probably benign	Het
Cradd	G	T	10: 95,175,804	S158*	probably null	Het
Dmxl1	G	A	18: 49,864,478	A578T	probably benign	Het
Drd2	A	G	9: 49,407,015	N419S	possibly damaging	Het
E4f1	T	C	17: 24,447,129	T232A	probably damaging	Het
Fat2	T	A	11: 55,281,130	E2919V	probably damaging	Het
Gc	T	C	5: 89,438,450		probably null	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hsd11b2	G	A	8: 105,522,511	V173I	probably benign	Het
Kdm6b	C	T	11: 69,406,074	A456T	probably damaging	Het
Kif18b	G	A	11: 102,908,189	P729S	possibly damaging	Het
Lgi1	A	G	19: 38,306,181	D467G	possibly damaging	Het
Loxl1	A	G	9: 58,312,367	Y174H	possibly damaging	Het
Mtus1	A	T	8: 41,022,555	I824N	probably damaging	Het
Myrf	C	T	19: 10,215,290	E622K	probably benign	Het
Ncam1	A	G	9: 49,545,751	Y416H	probably damaging	Het
Nceh1	A	G	3: 27,226,099	T132A	probably benign	Het
Nhlrc4	G	A	17: 25,943,492	P94S	probably damaging	Het
Olfr56	C	G	11: 49,135,114	D307E	probably benign	Het
Olfr591	A	T	7: 103,173,634	M1K	probably null	Het
Olfr906	A	T	9: 38,488,525	R165S	possibly damaging	Het
Pcdhac2	A	G	18: 37,144,423	Y152C	probably damaging	Het
Pdia3	C	A	2: 121,414,130	T8K	possibly damaging	Het
Pogz	T	A	3: 94,864,509	V304E	probably damaging	Het
Snrnp200	A	G	2: 127,226,087	S835G	possibly damaging	Het
Susd4	T	C	1: 182,892,070	S417P	probably benign	Het
Thsd7b	G	A	1: 129,595,841	R127H	probably damaging	Het
Tmco4	A	G	4: 139,053,905	D460G	probably damaging	Het
Ttll9	T	A	2: 152,984,314	M148K	probably damaging	Het
Ubn2	G	A	6: 38,490,388	C677Y	probably benign	Het
Wdfy4	C	A	14: 33,133,497	C720F	probably damaging	Het
Zzef1	G	A	11: 72,916,521	D2742N	probably damaging	Het

Other mutations in Vmn2r98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Vmn2r98	APN	17	19065745	splice site	probably benign
IGL01296:Vmn2r98	APN	17	19065185	missense	probably damaging	1.00
IGL01363:Vmn2r98	APN	17	19065758	missense	probably benign	0.01
IGL01618:Vmn2r98	APN	17	19065259	missense	possibly damaging	0.93
IGL01746:Vmn2r98	APN	17	19066451	missense	probably damaging	1.00
IGL01747:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01770:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01868:Vmn2r98	APN	17	19066286	missense	probably benign
IGL02123:Vmn2r98	APN	17	19080679	missense	probably damaging	1.00
IGL02323:Vmn2r98	APN	17	19065851	missense	probably damaging	0.99
IGL02543:Vmn2r98	APN	17	19065821	missense	probably benign
IGL02650:Vmn2r98	APN	17	19080961	missense	probably benign	0.00
IGL02676:Vmn2r98	APN	17	19065259	missense	probably benign	0.00
IGL02803:Vmn2r98	APN	17	19066013	missense	probably benign
IGL02807:Vmn2r98	APN	17	19081021	missense	probably damaging	1.00
IGL03307:Vmn2r98	APN	17	19065980	missense	possibly damaging	0.62
IGL03396:Vmn2r98	APN	17	19069845	missense	possibly damaging	0.92
PIT4131001:Vmn2r98	UTSW	17	19080961	missense	probably benign	0.00
R0122:Vmn2r98	UTSW	17	19066400	missense	probably benign	0.06
R0329:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0330:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0368:Vmn2r98	UTSW	17	19065827	nonsense	probably null
R0545:Vmn2r98	UTSW	17	19053613	missense	probably benign	0.15
R0635:Vmn2r98	UTSW	17	19080497	missense	probably benign	0.00
R0689:Vmn2r98	UTSW	17	19080520	missense	possibly damaging	0.83
R1035:Vmn2r98	UTSW	17	19080749	missense	possibly damaging	0.90
R1243:Vmn2r98	UTSW	17	19065948	missense	possibly damaging	0.52
R1421:Vmn2r98	UTSW	17	19065178	missense	probably damaging	1.00
R1629:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R1643:Vmn2r98	UTSW	17	19080908	missense	probably damaging	1.00
R1795:Vmn2r98	UTSW	17	19066440	missense	probably damaging	1.00
R1958:Vmn2r98	UTSW	17	19066418	missense	possibly damaging	0.70
R1962:Vmn2r98	UTSW	17	19065333	nonsense	probably null
R2165:Vmn2r98	UTSW	17	19081291	missense	unknown
R2238:Vmn2r98	UTSW	17	19065951	missense	probably damaging	1.00
R2252:Vmn2r98	UTSW	17	19080436	missense	probably benign	0.00
R2323:Vmn2r98	UTSW	17	19065819	missense	probably benign	0.18
R2887:Vmn2r98	UTSW	17	19081177	missense	possibly damaging	0.83
R2909:Vmn2r98	UTSW	17	19067402	missense	probably damaging	1.00
R3001:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3002:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3003:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3788:Vmn2r98	UTSW	17	19080625	missense	probably benign	0.31
R4570:Vmn2r98	UTSW	17	19066092	missense	probably benign	0.11
R4706:Vmn2r98	UTSW	17	19069745	missense	probably damaging	1.00
R4723:Vmn2r98	UTSW	17	19066340	missense	probably benign	0.01
R5036:Vmn2r98	UTSW	17	19066157	missense	probably benign	0.00
R5072:Vmn2r98	UTSW	17	19066044	missense	probably benign	0.07
R5121:Vmn2r98	UTSW	17	19053553	missense	probably benign	0.13
R5283:Vmn2r98	UTSW	17	19080719	missense	probably benign	0.05
R5294:Vmn2r98	UTSW	17	19069754	nonsense	probably null
R5371:Vmn2r98	UTSW	17	19069753	missense	probably damaging	1.00
R5532:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R5800:Vmn2r98	UTSW	17	19065998	missense	probably benign	0.17
R6089:Vmn2r98	UTSW	17	19066074	missense	probably benign	0.29
R6155:Vmn2r98	UTSW	17	19065881	missense	possibly damaging	0.87
R6853:Vmn2r98	UTSW	17	19065801	missense	probably benign	0.00
R6920:Vmn2r98	UTSW	17	19065248	missense	probably damaging	0.98
R7012:Vmn2r98	UTSW	17	19066268	missense	probably benign	0.06
R7042:Vmn2r98	UTSW	17	19080922	missense	probably benign
R7068:Vmn2r98	UTSW	17	19065313	missense	probably benign
R7607:Vmn2r98	UTSW	17	19067308	missense	possibly damaging	0.95
R7763:Vmn2r98	UTSW	17	19080535	missense	probably benign	0.00
R7771:Vmn2r98	UTSW	17	19067198	splice site	probably null
R7915:Vmn2r98	UTSW	17	19067231	missense	probably benign	0.10
R8028:Vmn2r98	UTSW	17	19053650	missense	probably benign	0.00
R8205:Vmn2r98	UTSW	17	19081163	missense	probably damaging	0.99
R8241:Vmn2r98	UTSW	17	19080769	missense	probably damaging	0.99
R8906:Vmn2r98	UTSW	17	19066270	missense	probably benign
R8952:Vmn2r98	UTSW	17	19065269	missense	possibly damaging	0.76
R9147:Vmn2r98	UTSW	17	19066121	missense	probably benign	0.04
R9148:Vmn2r98	UTSW	17	19066121	missense	probably benign	0.04
R9187:Vmn2r98	UTSW	17	19081219	missense	probably damaging	1.00
R9344:Vmn2r98	UTSW	17	19066515	missense	probably benign	0.14
R9467:Vmn2r98	UTSW	17	19067255	missense	probably benign	0.01
R9487:Vmn2r98	UTSW	17	19081234	missense	possibly damaging	0.78
R9753:Vmn2r98	UTSW	17	19065403	missense	probably benign	0.27
Z1177:Vmn2r98	UTSW	17	19065136	critical splice acceptor site	probably null
Z1177:Vmn2r98	UTSW	17	19067423	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGTGTTGGCCAAAGCTATCAC -3'
(R):5'- ATGGCCACCATGACCTTTCC -3'

Sequencing Primer
(F):5'- AAAGCTATCACTGTGGTCCTTG -3'
(R):5'- ACCTTTCCTTTAGTGCTGTGGTAGAC -3'

Posted On

2016-10-26