Incidental Mutation 'R5600:Apol11b'
ID438999
Institutional Source Beutler Lab
Gene Symbol Apol11b
Ensembl Gene ENSMUSG00000091694
Gene Nameapolipoprotein L 11b
SynonymsA330102K04Rik
MMRRC Submission 043152-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5600 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location77633946-77643286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 77635088 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 264 (M264R)
Ref Sequence ENSEMBL: ENSMUSP00000137890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166623] [ENSMUST00000180949] [ENSMUST00000181154] [ENSMUST00000181467]
Predicted Effect probably damaging
Transcript: ENSMUST00000166623
AA Change: M264R

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129476
Gene: ENSMUSG00000091694
AA Change: M264R

DomainStartEndE-ValueType
Pfam:ApoL 30 311 8.6e-78 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180949
AA Change: M264R

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137890
Gene: ENSMUSG00000091694
AA Change: M264R

DomainStartEndE-ValueType
Pfam:ApoL 29 323 5.1e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181154
SMART Domains Protein: ENSMUSP00000137798
Gene: ENSMUSG00000091694

DomainStartEndE-ValueType
Pfam:ApoL 29 76 5.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181467
SMART Domains Protein: ENSMUSP00000138009
Gene: ENSMUSG00000091694

DomainStartEndE-ValueType
Pfam:ApoL 1 144 2.3e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asprv1 G T 6: 86,629,062 E297* probably null Het
Atp6v1c1 T C 15: 38,686,863 V234A probably benign Het
Ccp110 G A 7: 118,729,725 probably null Het
Fgfrl1 T C 5: 108,705,302 C173R probably damaging Het
Gm5431 G A 11: 48,894,756 T264M possibly damaging Het
Golga1 T C 2: 39,020,099 E637G probably damaging Het
Gpr158 A G 2: 21,827,235 T1049A probably benign Het
Hcn4 T A 9: 58,859,293 probably null Het
Krt86 G A 15: 101,476,505 V260I probably benign Het
Ktn1 A T 14: 47,690,033 Q548L probably damaging Het
Lingo4 A T 3: 94,401,913 I53F probably benign Het
Lrrk1 A C 7: 66,307,215 I336S probably benign Het
Magel2 G T 7: 62,379,766 G806V unknown Het
Mrc2 T A 11: 105,333,666 S501T probably damaging Het
Mrps18a T A 17: 46,125,649 L128* probably null Het
Mtor G T 4: 148,491,470 L1360F probably damaging Het
Mtpap A G 18: 4,379,674 E88G probably damaging Het
Myo5c A G 9: 75,289,154 K1294R probably benign Het
Olfr118 G A 17: 37,672,285 M87I possibly damaging Het
Pik3c3 G A 18: 30,311,293 V520M probably damaging Het
Pptc7 T A 5: 122,320,855 V305E probably damaging Het
Ptgfrn T C 3: 101,056,250 D682G probably damaging Het
Rfx6 A T 10: 51,723,061 Q538L probably damaging Het
Sbk1 G A 7: 126,292,243 R283H probably damaging Het
Sfswap T C 5: 129,513,158 F240L probably damaging Het
Siglec1 T A 2: 131,085,583 H101L probably benign Het
Smg1 A G 7: 118,167,884 probably benign Het
Spink5 A G 18: 44,018,711 T986A probably damaging Het
Stat1 T A 1: 52,148,942 S496T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tenm2 C T 11: 36,163,714 probably null Het
Tiam1 G T 16: 89,865,365 R622S probably damaging Het
Vmn2r109 C A 17: 20,540,927 D723Y probably damaging Het
Vmn2r70 G T 7: 85,563,727 Q491K probably benign Het
Wdr66 T C 5: 123,288,698 V383A possibly damaging Het
Wnk1 A C 6: 119,949,358 S1297R probably damaging Het
Zan C T 5: 137,386,971 V5067I unknown Het
Zfp108 A G 7: 24,260,586 S201G probably benign Het
Other mutations in Apol11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01295:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01398:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01399:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01400:Apol11b APN 15 77638019 missense probably damaging 0.99
IGL01402:Apol11b APN 15 77638019 missense probably damaging 0.99
R1815:Apol11b UTSW 15 77635572 missense probably damaging 1.00
R2327:Apol11b UTSW 15 77637953 missense probably damaging 0.97
R3917:Apol11b UTSW 15 77635304 missense probably benign 0.03
R4424:Apol11b UTSW 15 77637933 critical splice donor site probably null
R4766:Apol11b UTSW 15 77634933 missense probably benign 0.00
R4804:Apol11b UTSW 15 77635266 missense probably damaging 1.00
R5440:Apol11b UTSW 15 77635593 nonsense probably null
R5866:Apol11b UTSW 15 77640547 missense probably null 0.97
R5997:Apol11b UTSW 15 77635497 missense probably benign 0.01
R6213:Apol11b UTSW 15 77638000 missense possibly damaging 0.82
R6249:Apol11b UTSW 15 77635337 missense probably benign 0.00
R6364:Apol11b UTSW 15 77638058 missense possibly damaging 0.46
R6984:Apol11b UTSW 15 77635346 missense probably benign 0.01
R8064:Apol11b UTSW 15 77635217 missense not run
Z1088:Apol11b UTSW 15 77638007 missense probably benign 0.17
Z1176:Apol11b UTSW 15 77638007 missense probably benign 0.17
Z1177:Apol11b UTSW 15 77638007 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTTCTGCTCAAATTTCTGAAGGTTC -3'
(R):5'- ACCTGATTGGAGCCAGCATG -3'

Sequencing Primer
(F):5'- GAAGGTTCTCCTCCAGCTTG -3'
(R):5'- ATTGGAGCCAGCATGAATGTTC -3'
Posted On2016-10-26