Mutagenetix > Incidental Mutations

Incidental Mutation 'R5695:Pacs1'

443907

Institutional Source

Beutler Lab

Gene Symbol

Pacs1

Ensembl Gene

ENSMUSG00000024855

Gene Name

phosphofurin acidic cluster sorting protein 1

Synonyms

MMRRC Submission

043326-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5695 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5133688-5273119 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 5136791 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 851 (F851S)

Ref Sequence

ENSEMBL: ENSMUSP00000025786 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025786]

AlphaFold

Q8K212

Predicted Effect

probably damaging
Transcript: ENSMUST00000025786
AA Change: F851S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: F851S

Domain	Start	End	E-Value	Type
low complexity region	5	24	N/A	INTRINSIC
low complexity region	27	46	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
low complexity region	276	290	N/A	INTRINSIC
low complexity region	306	320	N/A	INTRINSIC
low complexity region	359	372	N/A	INTRINSIC
Pfam:Pacs-1	546	958	2e-193	PFAM

Meta Mutation Damage Score

0.9694

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd4	T	A	12: 84,613,971	H116L	probably damaging	Het
Anapc4	C	T	5: 52,862,239	S581L	probably benign	Het
Ano8	A	C	8: 71,483,243	D276E	probably damaging	Het
Aspm	G	A	1: 139,479,669	R2098H	probably benign	Het
Bend7	G	A	2: 4,763,241	R336Q	probably damaging	Het
Bpifb4	G	A	2: 153,942,923	G184S	probably damaging	Het
Cbx8	T	C	11: 119,039,311	D152G	probably benign	Het
Cdca2	A	G	14: 67,705,629		probably null	Het
Cgn	G	A	3: 94,773,635	A531V	probably benign	Het
Cmya5	C	A	13: 93,045,866		probably null	Het
Cntnap3	A	G	13: 64,787,955	S365P	probably damaging	Het
Crnn	A	G	3: 93,149,023	Q372R	probably damaging	Het
Ehf	T	A	2: 103,266,779	E276V	probably damaging	Het
Eif4g3	T	A	4: 138,163,433		probably null	Het
Enpep	C	T	3: 129,309,099	D403N	probably damaging	Het
Enpp1	T	C	10: 24,654,908	E550G	probably damaging	Het
Entpd8	A	G	2: 25,084,334	D377G	probably benign	Het
Epc2	T	A	2: 49,547,607		probably null	Het
Erich3	G	T	3: 154,733,573	G481V	probably damaging	Het
Fank1	A	G	7: 133,869,346	Y156C	probably damaging	Het
Fras1	A	G	5: 96,781,344	D3869G	probably damaging	Het
Gcnt2	A	G	13: 40,918,199	D106G	probably benign	Het
Gm20830	A	T	Y: 6,916,501	V206E	probably benign	Het
Gmpr2	T	C	14: 55,677,234	V228A	possibly damaging	Het
Gon4l	TGAGCA	TGAGCAGAGCA	3: 88,896,216		probably null	Het
Gtpbp1	G	A	15: 79,712,174		probably null	Het
Hhat	A	T	1: 192,717,019	M271K	probably damaging	Het
Hipk2	A	T	6: 38,818,875	M153K	possibly damaging	Het
Hydin	A	T	8: 110,535,283	H2672L	probably benign	Het
Igfbpl1	A	T	4: 45,826,374	D140E	probably damaging	Het
Kctd1	T	G	18: 15,063,516		probably benign	Het
Lax1	A	T	1: 133,680,578	Y142N	probably damaging	Het
Lpin2	C	T	17: 71,244,803	R733C	probably damaging	Het
Morn4	A	G	19: 42,076,117	L144P	possibly damaging	Het
Nup214	C	A	2: 32,034,373	T1638K	probably damaging	Het
Nyap1	C	T	5: 137,734,984	A596T	probably damaging	Het
Oas1d	T	C	5: 120,915,011	M43T	probably benign	Het
Olfr724	T	C	14: 49,960,623	T150A	probably benign	Het
Olfr901	A	G	9: 38,431,176	H298R	probably benign	Het
Olfr986	T	C	9: 40,187,601	V162A	probably benign	Het
Pcdh17	A	G	14: 84,446,360	Q89R	probably damaging	Het
Phrf1	A	G	7: 141,258,465		probably benign	Het
Plekhb1	A	T	7: 100,655,395	I34N	probably damaging	Het
Ralgapa2	T	C	2: 146,333,477	E1800G	probably damaging	Het
Rbm33	A	T	5: 28,339,012	I89F	probably damaging	Het
Rtl1	T	A	12: 109,594,097	E436V	probably damaging	Het
Slc2a4	G	T	11: 69,946,391	P73Q	probably damaging	Het
Sorbs2	A	T	8: 45,792,875	T311S	probably benign	Het
Sulf2	G	A	2: 166,132,758	A2V	probably benign	Het
Supt16	A	T	14: 52,174,144		probably null	Het
Vmn1r26	A	T	6: 58,008,753	N150K	probably damaging	Het
Vmn2r39	T	A	7: 9,025,151	H407L	possibly damaging	Het
Vmn2r84	T	A	10: 130,389,195	Y482F	probably benign	Het
Vps9d1	T	C	8: 123,246,916	E376G	probably benign	Het
Wrn	C	A	8: 33,324,318	G366V	probably benign	Het

Other mutations in Pacs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Pacs1	APN	19	5153698	missense	probably damaging	0.98
IGL01335:Pacs1	APN	19	5142632	missense	probably damaging	1.00
IGL01717:Pacs1	APN	19	5167972	missense	probably damaging	1.00
IGL02453:Pacs1	APN	19	5135005	missense	probably damaging	1.00
IGL02887:Pacs1	APN	19	5135110	splice site	probably benign
Batavian	UTSW	19	5156413	missense	possibly damaging	0.71
chicory	UTSW	19	5139297	missense	probably benign	0.33
endive	UTSW	19	5272583	nonsense	probably null
Escarole	UTSW	19	5156356	critical splice donor site	probably null
frisee	UTSW	19	5136791	missense	probably damaging	1.00
R0240:Pacs1	UTSW	19	5156374	missense	possibly damaging	0.69
R0240:Pacs1	UTSW	19	5156374	missense	possibly damaging	0.69
R0316:Pacs1	UTSW	19	5135121	splice site	silent
R0369:Pacs1	UTSW	19	5141698	missense	probably damaging	1.00
R0443:Pacs1	UTSW	19	5272583	nonsense	probably null
R0973:Pacs1	UTSW	19	5143829	missense	probably damaging	1.00
R0973:Pacs1	UTSW	19	5143829	missense	probably damaging	1.00
R0974:Pacs1	UTSW	19	5143829	missense	probably damaging	1.00
R1202:Pacs1	UTSW	19	5135237	missense	probably damaging	1.00
R1672:Pacs1	UTSW	19	5152309	missense	probably benign	0.00
R1689:Pacs1	UTSW	19	5272615	unclassified	probably benign
R1842:Pacs1	UTSW	19	5155884	missense	probably damaging	0.96
R1847:Pacs1	UTSW	19	5153714	missense	probably damaging	0.99
R3884:Pacs1	UTSW	19	5155759	missense	probably damaging	0.99
R4577:Pacs1	UTSW	19	5143833	nonsense	probably null
R4630:Pacs1	UTSW	19	5156356	critical splice donor site	probably null
R5029:Pacs1	UTSW	19	5142271	missense	probably benign	0.03
R5198:Pacs1	UTSW	19	5139297	missense	probably benign	0.33
R5223:Pacs1	UTSW	19	5145141	missense	probably benign	0.00
R5464:Pacs1	UTSW	19	5147207	missense	probably benign
R6128:Pacs1	UTSW	19	5152372	splice site	probably null
R6335:Pacs1	UTSW	19	5159977	missense	probably damaging	1.00
R6802:Pacs1	UTSW	19	5152784	missense	probably damaging	0.99
R6831:Pacs1	UTSW	19	5160795	missense	probably damaging	1.00
R7071:Pacs1	UTSW	19	5156374	missense	possibly damaging	0.69
R7200:Pacs1	UTSW	19	5156413	missense	possibly damaging	0.71
R7248:Pacs1	UTSW	19	5138975	missense	probably damaging	1.00
R7576:Pacs1	UTSW	19	5145120	missense	probably benign	0.09
R7682:Pacs1	UTSW	19	5152699	missense	probably damaging	0.99
R7715:Pacs1	UTSW	19	5141681	missense	probably benign	0.01
R7738:Pacs1	UTSW	19	5152350	missense	probably benign	0.11
R8339:Pacs1	UTSW	19	5142623	missense	probably damaging	1.00
R8930:Pacs1	UTSW	19	5135002	missense	probably damaging	1.00
R8932:Pacs1	UTSW	19	5135002	missense	probably damaging	1.00
R9043:Pacs1	UTSW	19	5138936	missense	probably benign	0.23
R9211:Pacs1	UTSW	19	5139029	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTAGCCTCAAGATCTGCATAC -3'
(R):5'- GGTTAGTCACTGAAGTCAAAGCC -3'

Sequencing Primer
(F):5'- CTTATCCAGAAGCAGATTTCGGC -3'
(R):5'- CACTGAAGTCAAAGCCAACATTTTG -3'

Posted On

2016-11-09