Mutagenetix > Incidental Mutation

Incidental Mutation 'R4887:Hivep3'

376958

Institutional Source

Beutler Lab

Gene Symbol

Hivep3

Ensembl Gene

ENSMUSG00000028634

Gene Name

human immunodeficiency virus type I enhancer binding protein 3

Synonyms

E030045D18Rik, Schnurri-3, Shn3, 2900056N03Rik, Krc

MMRRC Submission

041979-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4887 (G1)

Quality Score

206

Status

Not validated

Chromosome

Chromosomal Location

119733784-120138045 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120122934 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1723 (E1723G)

Ref Sequence

ENSEMBL: ENSMUSP00000130249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106307] [ENSMUST00000166542]

AlphaFold

A2A884

Predicted Effect

probably damaging
Transcript: ENSMUST00000106307
AA Change: E1723G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101914
Gene: ENSMUSG00000028634
AA Change: E1723G

Domain	Start	End	E-Value	Type
ZnF_C2H2	185	207	1.67e-2	SMART
ZnF_C2H2	213	235	8.34e-3	SMART
low complexity region	257	285	N/A	INTRINSIC
low complexity region	292	323	N/A	INTRINSIC
low complexity region	425	438	N/A	INTRINSIC
low complexity region	513	527	N/A	INTRINSIC
low complexity region	589	612	N/A	INTRINSIC
low complexity region	622	633	N/A	INTRINSIC
ZnF_C2H2	636	656	2.06e1	SMART
low complexity region	736	749	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
low complexity region	844	865	N/A	INTRINSIC
low complexity region	878	894	N/A	INTRINSIC
low complexity region	896	931	N/A	INTRINSIC
low complexity region	1010	1020	N/A	INTRINSIC
low complexity region	1050	1061	N/A	INTRINSIC
low complexity region	1110	1136	N/A	INTRINSIC
low complexity region	1143	1167	N/A	INTRINSIC
low complexity region	1170	1183	N/A	INTRINSIC
low complexity region	1259	1284	N/A	INTRINSIC
low complexity region	1376	1390	N/A	INTRINSIC
low complexity region	1529	1547	N/A	INTRINSIC
low complexity region	1673	1684	N/A	INTRINSIC
ZnF_C2H2	1720	1742	1.82e-3	SMART
ZnF_C2H2	1748	1772	1.69e-3	SMART
low complexity region	1778	1791	N/A	INTRINSIC
low complexity region	1814	1843	N/A	INTRINSIC
low complexity region	2203	2216	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166542
AA Change: E1723G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130249
Gene: ENSMUSG00000028634
AA Change: E1723G

Domain	Start	End	E-Value	Type
ZnF_C2H2	185	207	1.67e-2	SMART
ZnF_C2H2	213	235	8.34e-3	SMART
low complexity region	257	285	N/A	INTRINSIC
low complexity region	292	323	N/A	INTRINSIC
low complexity region	425	438	N/A	INTRINSIC
low complexity region	513	527	N/A	INTRINSIC
low complexity region	589	612	N/A	INTRINSIC
low complexity region	622	633	N/A	INTRINSIC
ZnF_C2H2	636	656	2.06e1	SMART
low complexity region	736	749	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
low complexity region	844	865	N/A	INTRINSIC
low complexity region	878	894	N/A	INTRINSIC
low complexity region	896	931	N/A	INTRINSIC
low complexity region	1010	1020	N/A	INTRINSIC
low complexity region	1050	1061	N/A	INTRINSIC
low complexity region	1110	1136	N/A	INTRINSIC
low complexity region	1143	1167	N/A	INTRINSIC
low complexity region	1170	1183	N/A	INTRINSIC
low complexity region	1259	1284	N/A	INTRINSIC
low complexity region	1376	1390	N/A	INTRINSIC
low complexity region	1529	1547	N/A	INTRINSIC
low complexity region	1673	1684	N/A	INTRINSIC
ZnF_C2H2	1720	1742	1.82e-3	SMART
ZnF_C2H2	1748	1772	1.69e-3	SMART
low complexity region	1778	1791	N/A	INTRINSIC
low complexity region	1814	1843	N/A	INTRINSIC
low complexity region	2203	2216	N/A	INTRINSIC

Meta Mutation Damage Score

0.1639

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the human immunodeficiency virus type 1 enhancer-binding protein family. Members of this protein family contain multiple zinc finger and acid-rich (ZAS) domains and serine-threonine rich regions. This protein acts as a transcription factor and is able to regulate nuclear factor kappaB-mediated transcription by binding the kappaB motif in target genes. This protein also binds the recombination signal sequence that flanks the V, D, and J regions of immunoglobulin and T-cell receptors. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutation of this gene results in diminished IL-2 production by stimulated CD4 cells. Mice homozygous for a knock-out allele exhibit increased bone volume. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,876,324	I22F	possibly damaging	Het
2310009B15Rik	A	C	1: 138,852,165	Y116*	probably null	Het
4930548H24Rik	A	G	5: 31,486,252	I109V	probably benign	Het
Acer3	T	C	7: 98,257,701	T91A	possibly damaging	Het
Adam12	T	C	7: 134,172,821	K20E	possibly damaging	Het
Adamtsl3	T	C	7: 82,574,614	V275A	possibly damaging	Het
Afg1l	C	T	10: 42,454,378	V98I	probably benign	Het
Alpk1	C	T	3: 127,673,475	G1052R	probably damaging	Het
Anln	A	T	9: 22,380,188	S115T	possibly damaging	Het
Apob	T	A	12: 8,013,099	N3827K	probably damaging	Het
Aqr	G	A	2: 114,150,509	L264F	probably damaging	Het
Arhgap33	T	C	7: 30,532,192	S123G	probably damaging	Het
Arvcf	C	T	16: 18,398,113	R333*	probably null	Het
Brca2	T	A	5: 150,556,937	L2724Q	probably damaging	Het
Btbd11	C	T	10: 85,387,378	T17M	unknown	Het
C2cd6	T	A	1: 59,094,734	T43S	probably benign	Het
Cacna1h	A	G	17: 25,377,287	V1920A	possibly damaging	Het
Capsl	A	T	15: 9,457,772	I26F	possibly damaging	Het
Card10	A	T	15: 78,781,524	V673E	possibly damaging	Het
Ccar1	A	G	10: 62,753,218	S829P	unknown	Het
Cdc42bpa	T	C	1: 180,144,635	M1334T	possibly damaging	Het
Ceacam2	C	T	7: 25,520,832	C267Y	probably benign	Het
Cep68	G	A	11: 20,239,239	T591M	probably benign	Het
Chil4	T	C	3: 106,204,144	K218R	probably benign	Het
Cldn14	G	T	16: 93,919,859	T33K	possibly damaging	Het
Copa	T	A	1: 172,092,276	C140S	probably benign	Het
Coq6	T	C	12: 84,372,296	L358P	probably damaging	Het
Cyfip1	C	T	7: 55,872,068	P40L	probably damaging	Het
Dennd2a	A	C	6: 39,497,159	S414A	probably benign	Het
Dpm1	T	C	2: 168,217,759	N139S	probably benign	Het
Dpp7	T	A	2: 25,352,758		probably null	Het
Ednrb	T	C	14: 103,820,011	I372V	possibly damaging	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Fam135a	G	A	1: 24,024,253	Q1087*	probably null	Het
Fancg	T	C	4: 43,006,866	T275A	probably benign	Het
Fbn1	T	A	2: 125,309,774	H2520L	probably damaging	Het
Fmn2	T	C	1: 174,581,961	S587P	unknown	Het
Foxr2	A	G	X: 153,130,316	Q61R	probably damaging	Het
Frrs1	A	G	3: 116,902,416	*124W	probably null	Het
Gm16432	A	G	1: 178,103,949	Y478C	unknown	Het
Gm7535	T	A	17: 17,911,071		probably benign	Het
Gm884	T	C	11: 103,614,872	H2090R	probably benign	Het
Gm996	G	A	2: 25,579,747	R51C	possibly damaging	Het
Herc3	T	C	6: 58,887,499	V706A	probably damaging	Het
Hist1h4a	T	C	13: 23,760,952	D69G	probably damaging	Het
Igsf9b	A	G	9: 27,322,650	I382V	probably benign	Het
Ints1	G	T	5: 139,771,156	T467N	possibly damaging	Het
Iqca	G	A	1: 90,045,701	T783M	probably damaging	Het
Kng1	A	G	16: 23,067,698	K131R	possibly damaging	Het
Krt35	T	C	11: 100,093,130	Y348C	probably damaging	Het
Ldlrad3	A	G	2: 102,113,536	C64R	probably damaging	Het
Lilr4b	C	T	10: 51,484,520	A272V	possibly damaging	Het
Ltn1	A	T	16: 87,398,809	C1276*	probably null	Het
Matn1	G	A	4: 130,952,114	A360T	probably benign	Het
Minpp1	G	A	19: 32,498,384	V306I	probably benign	Het
Mkx	G	A	18: 6,992,904	R127W	probably damaging	Het
Mrpl48	G	T	7: 100,546,409		probably benign	Het
Ms4a2	A	G	19: 11,618,429	L166S	possibly damaging	Het
Mtus2	T	A	5: 148,077,103	Y235*	probably null	Het
Myh4	G	T	11: 67,241,054	W113C	probably damaging	Het
Nav2	T	A	7: 49,548,434	C1270*	probably null	Het
Ncoa5	A	G	2: 165,002,150	L111P	probably damaging	Het
Nup107	T	C	10: 117,770,478	Y453C	probably damaging	Het
Oca2	C	T	7: 56,330,358	Q604*	probably null	Het
Olfr116	A	T	17: 37,623,891	V248D	probably damaging	Het
Olfr1339	A	C	4: 118,734,688	H53P	probably benign	Het
Olfr482	T	A	7: 108,095,096	N158I	probably benign	Het
Olfr525	T	C	7: 140,323,101	M134T	probably benign	Het
Olfr952	T	C	9: 39,426,235	T279A	possibly damaging	Het
Pde3a	G	T	6: 141,470,942	G514V	possibly damaging	Het
Pik3cb	A	T	9: 99,101,328	C76S	probably damaging	Het
Plk1	T	C	7: 122,168,605	V411A	probably damaging	Het
Pole	C	T	5: 110,324,753	P1600L	probably damaging	Het
Prr36	T	C	8: 4,210,881	T979A	probably benign	Het
Rdh7	T	A	10: 127,885,721	T229S	probably benign	Het
Rnpepl1	A	T	1: 92,915,113	T140S	probably damaging	Het
Rps6kc1	A	T	1: 190,798,694	S947T	probably benign	Het
Rtl1	A	G	12: 109,591,704	F1234L	probably damaging	Het
Sdc1	G	A	12: 8,791,708	M279I	probably damaging	Het
Siae	T	C	9: 37,627,800	L169P	possibly damaging	Het
Slc22a22	C	T	15: 57,249,752	V364I	probably benign	Het
Sltm	G	T	9: 70,588,978	V932F	probably damaging	Het
Smad1	A	G	8: 79,349,752	L279P	probably damaging	Het
Spag17	G	T	3: 100,050,831	G935V	probably damaging	Het
Srgap3	A	G	6: 112,746,934	S546P	probably damaging	Het
Stxbp5	T	C	10: 9,809,100	I519V	probably benign	Het
Syt16	A	T	12: 74,129,386	I10F	probably damaging	Het
Trim43b	C	G	9: 89,091,312	G123R	probably damaging	Het
Ubr3	T	C	2: 70,013,131	Y1572H	probably damaging	Het
Umodl1	G	A	17: 31,008,665	R1324H	probably benign	Het
Vmn2r44	A	T	7: 8,377,986	W303R	probably benign	Het
Wdr93	T	C	7: 79,785,774	Y684H	probably damaging	Het
Wnk2	G	A	13: 49,071,002	R268C	probably damaging	Het
Zfp438	C	T	18: 5,213,776	C394Y	possibly damaging	Het

Other mutations in Hivep3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00953:Hivep3	APN	4	120098374	missense	probably damaging	1.00
IGL01017:Hivep3	APN	4	120099246	missense	probably damaging	0.98
IGL01837:Hivep3	APN	4	120094562	missense	possibly damaging	0.72
IGL01878:Hivep3	APN	4	120095227	missense	possibly damaging	0.84
IGL02134:Hivep3	APN	4	120133574	splice site	probably benign
IGL02183:Hivep3	APN	4	120132024	missense	probably benign	0.04
IGL02350:Hivep3	APN	4	120123025	missense	probably damaging	1.00
IGL02451:Hivep3	APN	4	120133965	missense	probably damaging	1.00
IGL02567:Hivep3	APN	4	120133956	missense	probably damaging	0.99
IGL02617:Hivep3	APN	4	120095444	missense	probably benign	0.04
IGL02725:Hivep3	APN	4	120095822	missense	possibly damaging	0.48
IGL02828:Hivep3	APN	4	120097732	nonsense	probably null
IGL02954:Hivep3	APN	4	120133641	missense	probably damaging	1.00
IGL02966:Hivep3	APN	4	120132186	missense	probably benign	0.04
Branchial	UTSW	4	120096575	missense	possibly damaging	0.92
Deceit	UTSW	4	120097911	frame shift	probably null
Mandible	UTSW	4	120097121	missense	probably damaging	0.99
Sclerotic	UTSW	4	120095099	missense	possibly damaging	0.82
Stealth	UTSW	4	120122876	nonsense	probably null
Yellowjacket	UTSW	4	120132357	missense	probably benign	0.01
PIT4260001:Hivep3	UTSW	4	120099182	missense	probably damaging	1.00
R0321:Hivep3	UTSW	4	120095591	missense	possibly damaging	0.84
R0336:Hivep3	UTSW	4	120103847	missense	probably damaging	1.00
R0558:Hivep3	UTSW	4	120096566	missense	probably damaging	0.98
R0562:Hivep3	UTSW	4	120096554	missense	probably benign	0.00
R0637:Hivep3	UTSW	4	120132541	nonsense	probably null
R0645:Hivep3	UTSW	4	120097334	missense	possibly damaging	0.95
R1186:Hivep3	UTSW	4	119814723	start gained	probably benign
R1254:Hivep3	UTSW	4	120099293	missense	probably damaging	1.00
R1428:Hivep3	UTSW	4	120096575	missense	possibly damaging	0.92
R1623:Hivep3	UTSW	4	120095704	missense	possibly damaging	0.84
R1739:Hivep3	UTSW	4	120095174	missense	probably benign	0.03
R1766:Hivep3	UTSW	4	120096671	missense	probably benign
R1769:Hivep3	UTSW	4	120097571	missense	possibly damaging	0.68
R1773:Hivep3	UTSW	4	120098837	missense	probably damaging	1.00
R1968:Hivep3	UTSW	4	120096238	missense	possibly damaging	0.83
R2220:Hivep3	UTSW	4	119734038	missense	possibly damaging	0.92
R2428:Hivep3	UTSW	4	120098508	nonsense	probably null
R3789:Hivep3	UTSW	4	120098416	missense	probably damaging	1.00
R3917:Hivep3	UTSW	4	120099427	missense	probably benign	0.27
R4366:Hivep3	UTSW	4	120096089	missense	possibly damaging	0.84
R4436:Hivep3	UTSW	4	120095923	missense	probably benign	0.11
R4504:Hivep3	UTSW	4	119733793	unclassified	probably benign
R4705:Hivep3	UTSW	4	119872050	intron	probably benign
R4713:Hivep3	UTSW	4	120131803	missense	probably damaging	1.00
R4756:Hivep3	UTSW	4	120097823	missense	probably damaging	0.98
R4888:Hivep3	UTSW	4	120122934	missense	probably damaging	1.00
R5008:Hivep3	UTSW	4	120098917	missense	probably benign	0.22
R5204:Hivep3	UTSW	4	120103856	critical splice donor site	probably null
R5594:Hivep3	UTSW	4	120123048	critical splice donor site	probably null
R5697:Hivep3	UTSW	4	120096955	missense	possibly damaging	0.68
R5715:Hivep3	UTSW	4	120096373	missense	probably benign
R5740:Hivep3	UTSW	4	120096023	missense	possibly damaging	0.83
R5760:Hivep3	UTSW	4	120095011	missense	possibly damaging	0.83
R5923:Hivep3	UTSW	4	120096293	missense	possibly damaging	0.92
R5927:Hivep3	UTSW	4	120097108	missense	possibly damaging	0.68
R6042:Hivep3	UTSW	4	120097864	missense	possibly damaging	0.85
R6074:Hivep3	UTSW	4	120097694	missense	possibly damaging	0.68
R6150:Hivep3	UTSW	4	119734077	nonsense	probably null
R6211:Hivep3	UTSW	4	120098405	missense	probably damaging	1.00
R6251:Hivep3	UTSW	4	120094940	missense	probably damaging	0.98
R6451:Hivep3	UTSW	4	120098908	missense	probably benign	0.22
R6531:Hivep3	UTSW	4	120122876	nonsense	probably null
R6651:Hivep3	UTSW	4	120122949	missense	probably damaging	1.00
R6701:Hivep3	UTSW	4	120094540	missense	probably damaging	0.97
R6721:Hivep3	UTSW	4	120095099	missense	possibly damaging	0.82
R6796:Hivep3	UTSW	4	120096361	missense	possibly damaging	0.68
R6864:Hivep3	UTSW	4	120094888	missense	possibly damaging	0.48
R6902:Hivep3	UTSW	4	120095995	missense	possibly damaging	0.48
R7111:Hivep3	UTSW	4	120095234	missense	possibly damaging	0.68
R7113:Hivep3	UTSW	4	120098369	missense	probably damaging	1.00
R7140:Hivep3	UTSW	4	120097121	missense	probably damaging	0.99
R7189:Hivep3	UTSW	4	120132219	missense	probably damaging	0.99
R7218:Hivep3	UTSW	4	120095452	missense	possibly damaging	0.92
R7366:Hivep3	UTSW	4	120097911	frame shift	probably null
R7368:Hivep3	UTSW	4	120097911	frame shift	probably null
R7491:Hivep3	UTSW	4	120098830	missense	probably benign	0.09
R7496:Hivep3	UTSW	4	120132402	missense	probably benign	0.00
R7514:Hivep3	UTSW	4	120096855	missense	possibly damaging	0.48
R7604:Hivep3	UTSW	4	120097911	frame shift	probably null
R7605:Hivep3	UTSW	4	120097911	frame shift	probably null
R7607:Hivep3	UTSW	4	120097911	frame shift	probably null
R7610:Hivep3	UTSW	4	120097911	frame shift	probably null
R7611:Hivep3	UTSW	4	120097911	frame shift	probably null
R7613:Hivep3	UTSW	4	120097911	frame shift	probably null
R7626:Hivep3	UTSW	4	120097911	frame shift	probably null
R7707:Hivep3	UTSW	4	119733959	missense
R7736:Hivep3	UTSW	4	120095543	missense	possibly damaging	0.92
R7915:Hivep3	UTSW	4	120097765	missense	possibly damaging	0.83
R7943:Hivep3	UTSW	4	120132357	missense	probably benign	0.01
R7972:Hivep3	UTSW	4	120097514	missense	possibly damaging	0.48
R8093:Hivep3	UTSW	4	120095435	missense	possibly damaging	0.68
R8111:Hivep3	UTSW	4	120098386	missense	probably damaging	0.99
R8215:Hivep3	UTSW	4	120122901	missense	probably damaging	1.00
R8364:Hivep3	UTSW	4	120099442	missense	probably benign	0.10
R8467:Hivep3	UTSW	4	120095041	missense	probably damaging	0.98
R8768:Hivep3	UTSW	4	120132324	missense	probably damaging	0.99
R8890:Hivep3	UTSW	4	120096460	missense	possibly damaging	0.95
R8902:Hivep3	UTSW	4	120096740	missense	possibly damaging	0.83
R9022:Hivep3	UTSW	4	120098107	missense	probably benign	0.09
R9336:Hivep3	UTSW	4	120095203	missense	possibly damaging	0.84
R9606:Hivep3	UTSW	4	120132589	missense	probably damaging	0.98
RF019:Hivep3	UTSW	4	120098270	missense	probably benign	0.12
X0062:Hivep3	UTSW	4	120098698	missense	probably damaging	1.00
X0067:Hivep3	UTSW	4	120131787	missense	probably damaging	0.96
Z1176:Hivep3	UTSW	4	120133782	missense	probably damaging	1.00
Z1177:Hivep3	UTSW	4	120095946	missense	possibly damaging	0.68
Z1177:Hivep3	UTSW	4	120131778	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTAGCTATAACACATCGCTTCCTC -3'
(R):5'- ACTCCAGTCCTTAGGCAGAG -3'

Sequencing Primer
(F):5'- ATAACACATCGCTTCCTCCAGTG -3'
(R):5'- GCTCTGTGCTGGGGCTC -3'

Posted On

2016-03-17