Incidental Mutation 'R5726:Podxl2'
ID452488
Institutional Source Beutler Lab
Gene Symbol Podxl2
Ensembl Gene ENSMUSG00000033152
Gene Namepodocalyxin-like 2
SynonymsPODLX2, D130074J02Rik
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location88842558-88875044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88848739 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 400 (D400G)
Ref Sequence ENSEMBL: ENSMUSP00000117954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038409] [ENSMUST00000061262] [ENSMUST00000140455] [ENSMUST00000145780] [ENSMUST00000145944]
Predicted Effect probably damaging
Transcript: ENSMUST00000038409
AA Change: D336G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040417
Gene: ENSMUSG00000033152
AA Change: D336G

DomainStartEndE-ValueType
coiled coil region 88 125 N/A INTRINSIC
low complexity region 132 152 N/A INTRINSIC
Pfam:CD34_antigen 328 539 9e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061262
AA Change: D336G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058985
Gene: ENSMUSG00000033152
AA Change: D336G

DomainStartEndE-ValueType
coiled coil region 88 125 N/A INTRINSIC
low complexity region 132 152 N/A INTRINSIC
Pfam:CD34_antigen 328 539 5.4e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124562
Predicted Effect probably benign
Transcript: ENSMUST00000140455
SMART Domains Protein: ENSMUSP00000120870
Gene: ENSMUSG00000033152

DomainStartEndE-ValueType
coiled coil region 88 125 N/A INTRINSIC
low complexity region 139 149 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141348
SMART Domains Protein: ENSMUSP00000121139
Gene: ENSMUSG00000033152

DomainStartEndE-ValueType
Pfam:CD34_antigen 77 176 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142266
Predicted Effect probably benign
Transcript: ENSMUST00000145780
SMART Domains Protein: ENSMUSP00000120460
Gene: ENSMUSG00000033152

DomainStartEndE-ValueType
coiled coil region 88 125 N/A INTRINSIC
low complexity region 139 149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145944
AA Change: D400G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117954
Gene: ENSMUSG00000033152
AA Change: D400G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
coiled coil region 152 189 N/A INTRINSIC
low complexity region 196 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205158
Meta Mutation Damage Score 0.4246 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the CD34 family of cell surface transmembrane proteins, which are characterized by an N-terminal extracellular mucin domain, globular and stalk domains, a single pass transmembrane region, and a charged cytoplasmic tail. The encoded protein is a ligand for vascular selectins. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Podxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:Podxl2 APN 6 88849349 missense probably benign 0.00
IGL01642:Podxl2 APN 6 88843547 missense probably damaging 1.00
R0295:Podxl2 UTSW 6 88849678 missense probably benign 0.06
R0336:Podxl2 UTSW 6 88849595 missense probably benign 0.12
R0625:Podxl2 UTSW 6 88849955 missense possibly damaging 0.74
R1239:Podxl2 UTSW 6 88849983 missense probably benign 0.35
R1316:Podxl2 UTSW 6 88849217 missense probably benign 0.05
R1650:Podxl2 UTSW 6 88849919 missense probably benign 0.06
R1933:Podxl2 UTSW 6 88849605 missense probably benign 0.05
R2338:Podxl2 UTSW 6 88849196 missense probably damaging 1.00
R3500:Podxl2 UTSW 6 88842918 missense probably damaging 1.00
R5243:Podxl2 UTSW 6 88849374 missense probably benign 0.00
R5763:Podxl2 UTSW 6 88849823 missense probably damaging 1.00
R6247:Podxl2 UTSW 6 88849317 nonsense probably null
R6527:Podxl2 UTSW 6 88842930 missense probably damaging 1.00
R7109:Podxl2 UTSW 6 88843584 missense possibly damaging 0.56
R7129:Podxl2 UTSW 6 88843505 critical splice donor site probably null
R7376:Podxl2 UTSW 6 88849650 missense probably benign 0.01
R7539:Podxl2 UTSW 6 88849329 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCGCTCACTGGAACAAAAGATC -3'
(R):5'- TTAGCCTTATGCACGCAGAG -3'

Sequencing Primer
(F):5'- GCTACATACTATGTTTGAGGTCAGCC -3'
(R):5'- GACCTGACACTGCAGCTC -3'
Posted On2017-01-03