Incidental Mutation 'R5726:Sstr4'
ID 452475
Institutional Source Beutler Lab
Gene Symbol Sstr4
Ensembl Gene ENSMUSG00000037014
Gene Name somatostatin receptor 4
Synonyms Smstr4, sst4
MMRRC Submission 043344-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R5726 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 148237297-148238684 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 148238003 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 205 (S205P)
Ref Sequence ENSEMBL: ENSMUSP00000105588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109962]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109962
AA Change: S205P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105588
Gene: ENSMUSG00000037014
AA Change: S205P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 55 323 4.7e-16 PFAM
Pfam:7tm_1 61 308 2.2e-61 PFAM
Pfam:7TM_GPCR_Srv 117 325 1.8e-10 PFAM
Pfam:7TM_GPCR_Srw 203 326 8.1e-9 PFAM
Meta Mutation Damage Score 0.2687 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR4 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in fetal and adult brain and lung. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have increased susceptibility to inflammation, delayed type hypersensitivity, hyperalgesia and airway hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 127,835,832 (GRCm39) K254E probably damaging Het
Aak1 C T 6: 86,902,106 (GRCm39) Q92* probably null Het
Acss3 T C 10: 106,959,183 (GRCm39) T88A possibly damaging Het
Adcy4 A T 14: 56,021,118 (GRCm39) S6R probably damaging Het
Aldh1l2 T C 10: 83,348,170 (GRCm39) E311G possibly damaging Het
Arhgap25 C T 6: 87,440,441 (GRCm39) S402N probably benign Het
Btn1a1 T A 13: 23,643,522 (GRCm39) D309V probably damaging Het
Cdh23 C T 10: 60,243,259 (GRCm39) V1037M probably damaging Het
Clcn2 T C 16: 20,529,285 (GRCm39) probably benign Het
Cln3 T C 7: 126,174,673 (GRCm39) T276A probably null Het
CN725425 A G 15: 91,144,706 (GRCm39) E523G possibly damaging Het
Crppa T C 12: 36,597,829 (GRCm39) V320A probably damaging Het
Cspg4 A T 9: 56,793,188 (GRCm39) T308S probably damaging Het
Dgkh G T 14: 78,862,342 (GRCm39) F208L probably benign Het
Eif2ak4 A G 2: 118,273,613 (GRCm39) D846G probably damaging Het
Fmo4 A G 1: 162,635,828 (GRCm39) probably null Het
Foxp4 A G 17: 48,180,033 (GRCm39) Y623H unknown Het
Fxr2 T C 11: 69,524,172 (GRCm39) V10A probably benign Het
Gm10271 T C 10: 116,792,792 (GRCm39) probably null Het
Gsk3b T C 16: 38,028,498 (GRCm39) probably benign Het
Ift43 T A 12: 86,208,957 (GRCm39) D169E probably damaging Het
Ift57 T A 16: 49,519,861 (GRCm39) L54H probably damaging Het
Ighv1-37 T C 12: 114,860,294 (GRCm39) probably benign Het
Kl A G 5: 150,915,003 (GRCm39) N910S possibly damaging Het
Lrp2 T C 2: 69,339,491 (GRCm39) D1140G probably damaging Het
Map1a G A 2: 121,135,546 (GRCm39) A1883T probably damaging Het
Map4k2 G T 19: 6,401,362 (GRCm39) G611C probably damaging Het
Mical1 A G 10: 41,359,692 (GRCm39) probably benign Het
Myh14 A G 7: 44,292,886 (GRCm39) probably null Het
Myh8 T A 11: 67,185,392 (GRCm39) V881D possibly damaging Het
Myo1g G T 11: 6,459,420 (GRCm39) Q817K probably benign Het
Nin A C 12: 70,124,953 (GRCm39) V123G probably damaging Het
Nup160 A G 2: 90,548,195 (GRCm39) D976G probably damaging Het
Nup210l A T 3: 90,036,514 (GRCm39) probably null Het
Or5an1c A G 19: 12,218,644 (GRCm39) I127T probably damaging Het
Phf14 T C 6: 11,933,537 (GRCm39) probably benign Het
Podxl2 T C 6: 88,825,721 (GRCm39) D400G probably damaging Het
Pygl C T 12: 70,237,916 (GRCm39) W707* probably null Het
Rnf19b T C 4: 128,965,685 (GRCm39) V261A possibly damaging Het
Rnf213 A G 11: 119,307,284 (GRCm39) Y648C probably damaging Het
Scn5a C T 9: 119,362,913 (GRCm39) R569H probably damaging Het
Sdk2 A G 11: 113,742,626 (GRCm39) L761P probably damaging Het
Shroom3 C T 5: 93,090,864 (GRCm39) P1124S probably benign Het
Sirt4 A G 5: 115,617,705 (GRCm39) V317A probably benign Het
Skic3 T C 13: 76,266,466 (GRCm39) Y238H probably damaging Het
Slc12a2 G T 18: 58,029,426 (GRCm39) A271S probably benign Het
Slc6a9 A G 4: 117,721,210 (GRCm39) Y208C probably damaging Het
Snap23 T A 2: 120,414,752 (GRCm39) probably benign Het
Sra1 C T 18: 36,803,226 (GRCm39) probably benign Het
Srbd1 C T 17: 86,428,157 (GRCm39) D359N possibly damaging Het
Srp19 A G 18: 34,464,826 (GRCm39) Y22C probably damaging Het
Sv2b T C 7: 74,773,962 (GRCm39) D503G possibly damaging Het
Tbc1d30 C T 10: 121,103,479 (GRCm39) V518M probably damaging Het
Tlr4 A G 4: 66,758,652 (GRCm39) K482E probably benign Het
Tpm1 G A 9: 66,930,694 (GRCm39) L310F probably damaging Het
Trpm6 A G 19: 18,830,981 (GRCm39) Y1282C probably damaging Het
Tsc22d1 T A 14: 76,742,757 (GRCm39) L65* probably null Het
Ttc39c C A 18: 12,830,992 (GRCm39) A284D probably damaging Het
Txndc16 G A 14: 45,403,221 (GRCm39) H297Y probably benign Het
Utrn A T 10: 12,545,550 (GRCm39) D1698E probably benign Het
Vmn1r232 C T 17: 21,133,601 (GRCm39) R333H probably benign Het
Vmn2r14 A T 5: 109,365,486 (GRCm39) D529E possibly damaging Het
Vmn2r70 C T 7: 85,208,315 (GRCm39) V721I probably damaging Het
Zbtb18 A G 1: 177,276,119 (GRCm39) H484R probably damaging Het
Zc3h13 T A 14: 75,568,269 (GRCm39) S1187R possibly damaging Het
Zfhx4 T A 3: 5,468,381 (GRCm39) D2846E probably benign Het
Other mutations in Sstr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Sstr4 APN 2 148,237,472 (GRCm39) missense probably benign 0.00
IGL01536:Sstr4 APN 2 148,237,800 (GRCm39) missense probably damaging 1.00
IGL02210:Sstr4 APN 2 148,238,229 (GRCm39) missense probably damaging 1.00
IGL02670:Sstr4 APN 2 148,238,453 (GRCm39) nonsense probably null
R0396:Sstr4 UTSW 2 148,238,181 (GRCm39) missense probably damaging 1.00
R1428:Sstr4 UTSW 2 148,238,279 (GRCm39) missense probably benign 0.01
R1839:Sstr4 UTSW 2 148,237,453 (GRCm39) missense probably benign 0.21
R2332:Sstr4 UTSW 2 148,238,330 (GRCm39) missense probably damaging 1.00
R2943:Sstr4 UTSW 2 148,238,085 (GRCm39) missense probably damaging 0.96
R3700:Sstr4 UTSW 2 148,238,273 (GRCm39) missense possibly damaging 0.57
R5502:Sstr4 UTSW 2 148,237,471 (GRCm39) small insertion probably benign
R5503:Sstr4 UTSW 2 148,237,471 (GRCm39) small insertion probably benign
R5596:Sstr4 UTSW 2 148,237,652 (GRCm39) missense possibly damaging 0.65
R6985:Sstr4 UTSW 2 148,238,169 (GRCm39) missense probably damaging 0.97
R8939:Sstr4 UTSW 2 148,238,228 (GRCm39) missense probably damaging 1.00
R8943:Sstr4 UTSW 2 148,237,782 (GRCm39) missense possibly damaging 0.94
X0022:Sstr4 UTSW 2 148,237,452 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGTGGCTGTTGTGCACCC -3'
(R):5'- GCTGCACCACATAGAAAGGC -3'

Sequencing Primer
(F):5'- CAAGCTAATCAACCTGGG -3'
(R):5'- AAGACGGTCACCACCATTAG -3'
Posted On 2017-01-03