Incidental Mutation 'R5882:Scnn1g'
ID 454470
Institutional Source Beutler Lab
Gene Symbol Scnn1g
Ensembl Gene ENSMUSG00000000216
Gene Name sodium channel, nonvoltage-gated 1 gamma
Synonyms ENaC gamma
MMRRC Submission 043236-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.667) question?
Stock # R5882 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 121734479-121768475 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121767358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 593 (S593C)
Ref Sequence ENSEMBL: ENSMUSP00000000221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000221]
AlphaFold Q9WU39
Predicted Effect possibly damaging
Transcript: ENSMUST00000000221
AA Change: S593C

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: S593C

DomainStartEndE-ValueType
Pfam:ASC 32 558 6.4e-91 PFAM
low complexity region 618 631 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.5%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7e T A 15: 77,718,247 H348Q probably benign Het
Cacna1g T A 11: 94,459,819 E400V probably damaging Het
Cyp2j6 T A 4: 96,535,602 K176N probably benign Het
Dcaf4 T C 12: 83,539,429 V377A probably damaging Het
Dennd1a A G 2: 37,961,663 L71P probably damaging Het
Dmbx1 G T 4: 115,920,301 R117S probably damaging Het
Ep400 A G 5: 110,755,587 V382A probably benign Het
Kars G A 8: 112,003,425 R107* probably null Het
Kif16b C T 2: 142,707,258 probably null Het
Lrrc69 A G 4: 14,708,690 F218S probably damaging Het
Myo15b A G 11: 115,869,596 Y1158C probably damaging Het
Myom1 G C 17: 71,110,722 A1307P probably damaging Het
Nacad C T 11: 6,598,568 V1389I possibly damaging Het
Nit2 T C 16: 57,159,466 D132G probably benign Het
Nln G T 13: 104,059,498 D60E probably benign Het
Oas1f G A 5: 120,848,253 E90K probably damaging Het
Obox3 A G 7: 15,626,968 V82A probably benign Het
Olfr1277 A T 2: 111,270,139 V76E probably damaging Het
Olfr874 C T 9: 37,746,632 T166I probably benign Het
Pcdhb1 A T 18: 37,267,177 Q727L probably benign Het
Phactr1 G T 13: 42,709,851 probably null Het
Prkg1 A T 19: 31,585,697 N116K probably damaging Het
Serpina6 T C 12: 103,654,235 N85S probably benign Het
Spock3 A G 8: 63,143,931 T93A probably benign Het
St7 T C 6: 17,846,249 L121P probably damaging Het
Stoml2 G C 4: 43,031,003 R57G probably damaging Het
Tdrd1 C T 19: 56,848,939 R532C probably damaging Het
Tmc5 A G 7: 118,654,919 N660S probably damaging Het
Tmem38a A G 8: 72,585,887 H233R probably damaging Het
Trp53bp2 T C 1: 182,442,212 V304A possibly damaging Het
Ush1g C A 11: 115,318,542 M275I probably damaging Het
Zfp882 A T 8: 71,913,459 probably null Het
Zim1 A T 7: 6,682,738 probably null Het
Other mutations in Scnn1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Scnn1g APN 7 121740437 missense probably benign 0.00
IGL01824:Scnn1g APN 7 121766293 missense probably benign 0.00
IGL02133:Scnn1g APN 7 121743699 missense probably damaging 1.00
IGL02529:Scnn1g APN 7 121742446 splice site probably benign
IGL02814:Scnn1g APN 7 121740365 missense probably damaging 1.00
IGL03091:Scnn1g APN 7 121746683 missense probably damaging 1.00
IGL03253:Scnn1g APN 7 121737933 nonsense probably null
PIT4504001:Scnn1g UTSW 7 121742331 missense probably benign 0.30
R0230:Scnn1g UTSW 7 121746761 splice site probably benign
R0324:Scnn1g UTSW 7 121740555 missense possibly damaging 0.62
R0367:Scnn1g UTSW 7 121746579 splice site probably benign
R0534:Scnn1g UTSW 7 121767424 missense probably benign 0.00
R1747:Scnn1g UTSW 7 121760463 missense probably damaging 0.99
R2004:Scnn1g UTSW 7 121738188 nonsense probably null
R2197:Scnn1g UTSW 7 121767296 missense probably damaging 1.00
R4396:Scnn1g UTSW 7 121740427 missense probably benign 0.01
R4804:Scnn1g UTSW 7 121763080 frame shift probably null
R4805:Scnn1g UTSW 7 121746602 missense probably damaging 1.00
R5219:Scnn1g UTSW 7 121766266 missense probably damaging 1.00
R5757:Scnn1g UTSW 7 121738215 missense probably damaging 1.00
R5910:Scnn1g UTSW 7 121738095 missense probably damaging 0.99
R6381:Scnn1g UTSW 7 121767499 missense probably benign 0.00
R6666:Scnn1g UTSW 7 121767388 missense probably benign 0.00
R6735:Scnn1g UTSW 7 121742263 missense probably benign 0.02
R6813:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6860:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6887:Scnn1g UTSW 7 121760444 missense probably benign 0.01
R7289:Scnn1g UTSW 7 121738081 nonsense probably null
R7488:Scnn1g UTSW 7 121763434 missense probably benign 0.00
R7630:Scnn1g UTSW 7 121760481 missense probably damaging 1.00
R7888:Scnn1g UTSW 7 121743655 missense probably damaging 0.97
R7917:Scnn1g UTSW 7 121743693 missense probably damaging 1.00
R9051:Scnn1g UTSW 7 121742343 missense possibly damaging 0.86
R9312:Scnn1g UTSW 7 121740595 missense probably benign 0.00
Z1177:Scnn1g UTSW 7 121760475 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGGTCTCCCTATAGCATGG -3'
(R):5'- TCAACTGAGTGTCTGTGAGCTG -3'

Sequencing Primer
(F):5'- GCAGATTGAGATGCTCCTGTCTAAC -3'
(R):5'- CTGGGAGGAAAAGGCACTGTC -3'
Posted On 2017-02-10