Incidental Mutation 'R5853:Mndal'
ID454744
Institutional Source Beutler Lab
Gene Symbol Mndal
Ensembl Gene ENSMUSG00000090272
Gene Namemyeloid nuclear differentiation antigen like
SynonymsGm2785
MMRRC Submission 044068-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5853 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173849126-173942491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 173862504 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 420 (G420V)
Ref Sequence ENSEMBL: ENSMUSP00000140610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111210] [ENSMUST00000186442] [ENSMUST00000188804] [ENSMUST00000190071]
Predicted Effect probably damaging
Transcript: ENSMUST00000111210
AA Change: G420V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272
AA Change: G420V

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186442
AA Change: G367V

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140539
Gene: ENSMUSG00000090272
AA Change: G367V

DomainStartEndE-ValueType
PYRIN 5 83 1.8e-24 SMART
internal_repeat_1 152 166 4.72e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 4.72e-7 PROSPERO
low complexity region 225 237 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
Pfam:HIN 258 427 2.9e-83 PFAM
low complexity region 444 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188804
AA Change: G420V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140610
Gene: ENSMUSG00000090272
AA Change: G420V

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 480 4.3e-86 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189474
Predicted Effect probably benign
Transcript: ENSMUST00000190071
SMART Domains Protein: ENSMUSP00000141055
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
internal_repeat_1 21 35 3.67e-8 PROSPERO
low complexity region 39 69 N/A INTRINSIC
internal_repeat_1 77 91 3.67e-8 PROSPERO
low complexity region 94 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220623
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 G A 7: 120,340,583 V303I probably benign Het
Abca4 G T 3: 122,103,531 V620L probably benign Het
Ankk1 A T 9: 49,418,695 V320E possibly damaging Het
Aoah G T 13: 20,999,902 A379S probably benign Het
Apol7e A G 15: 77,714,467 D44G probably benign Het
Atf2 T C 2: 73,828,469 probably null Het
Cd209b T C 8: 3,926,549 probably null Het
Chek1 G A 9: 36,713,687 S366L probably damaging Het
Chpf2 T C 5: 24,592,192 L712P probably damaging Het
Clmn C A 12: 104,783,902 probably null Het
Cnksr3 T C 10: 7,142,977 D178G probably benign Het
Cpox T C 16: 58,675,417 Y366H probably damaging Het
Dnah3 A G 7: 119,938,833 F3632S probably damaging Het
Eif5b T A 1: 38,037,307 D645E probably damaging Het
Emilin1 G A 5: 30,918,622 E736K probably damaging Het
Gcnt4 G A 13: 96,946,652 R152Q probably benign Het
Il6st T C 13: 112,481,537 S162P probably damaging Het
Iqub T C 6: 24,491,602 K362E probably benign Het
Kif22 G T 7: 127,033,367 P257Q possibly damaging Het
Lhx2 T C 2: 38,369,041 V378A probably damaging Het
Lipo1 A G 19: 33,782,230 V202A probably benign Het
Lrp1b T A 2: 40,663,726 N366I unknown Het
Mbip T C 12: 56,335,877 D268G probably damaging Het
Mc5r A G 18: 68,339,493 M308V probably benign Het
Nbea A T 3: 55,992,401 N1442K probably damaging Het
Ndufv1 A T 19: 4,008,811 probably null Het
Ofcc1 A G 13: 40,206,717 S279P probably benign Het
Olfr1415 T C 1: 92,491,717 I13V probably benign Het
Olfr730 A T 14: 50,186,869 M116K possibly damaging Het
Pabpc1l A T 2: 164,049,518 H552L probably benign Het
Pigr T A 1: 130,846,604 C440* probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prss30 C T 17: 23,972,846 V271I probably damaging Het
Psme4 T A 11: 30,791,234 probably null Het
Qrich1 T A 9: 108,533,608 probably benign Het
Rem1 C G 2: 152,628,280 A62G possibly damaging Het
Rftn1 T C 17: 50,047,326 N58S probably damaging Het
Rp9 G A 9: 22,448,769 probably benign Het
Rrp1b G A 17: 32,056,684 V402I possibly damaging Het
Slc25a33 A T 4: 149,753,892 Y108N probably benign Het
Slc3a1 A G 17: 85,032,580 M189V probably damaging Het
Slc44a1 A C 4: 53,528,682 K144T probably benign Het
Tbc1d13 T A 2: 30,137,381 H100Q probably damaging Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tmem70 T C 1: 16,665,332 W9R possibly damaging Het
Tspan1 A G 4: 116,163,305 probably null Het
Unc13a T C 8: 71,655,129 probably null Het
Uroc1 T C 6: 90,346,756 F395S probably damaging Het
Uvrag A C 7: 98,888,077 L637R possibly damaging Het
Vmn1r213 T G 13: 23,011,514 L3W probably benign Het
Zfp280d C T 9: 72,330,942 T528I probably benign Het
Zfp526 C T 7: 25,225,176 Q287* probably null Het
Other mutations in Mndal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Mndal APN 1 173857456 missense possibly damaging 0.68
IGL02309:Mndal APN 1 173874455 missense probably damaging 0.98
IGL02559:Mndal APN 1 173872920 missense probably benign 0.06
IGL02637:Mndal APN 1 173857437 missense possibly damaging 0.63
LCD18:Mndal UTSW 1 173880218 unclassified probably benign
R0076:Mndal UTSW 1 173874447 nonsense probably null
R0123:Mndal UTSW 1 173857513 splice site probably benign
R0134:Mndal UTSW 1 173857513 splice site probably benign
R0225:Mndal UTSW 1 173857513 splice site probably benign
R0976:Mndal UTSW 1 173862845 missense possibly damaging 0.70
R1081:Mndal UTSW 1 173860222 missense probably benign 0.01
R1497:Mndal UTSW 1 173872875 missense probably benign 0.04
R1522:Mndal UTSW 1 173871466 missense possibly damaging 0.68
R1630:Mndal UTSW 1 173874392 missense possibly damaging 0.52
R1874:Mndal UTSW 1 173860367 unclassified probably benign
R4183:Mndal UTSW 1 173875771 missense possibly damaging 0.95
R4544:Mndal UTSW 1 173875664 nonsense probably null
R4545:Mndal UTSW 1 173875664 nonsense probably null
R4907:Mndal UTSW 1 173862690 missense probably damaging 0.99
R5066:Mndal UTSW 1 173875663 missense probably damaging 1.00
R6208:Mndal UTSW 1 173857422 missense possibly damaging 0.84
R6395:Mndal UTSW 1 173871433 missense possibly damaging 0.73
R6923:Mndal UTSW 1 173884698 splice site probably null
R6933:Mndal UTSW 1 173875683 missense probably damaging 1.00
R7030:Mndal UTSW 1 173875594 missense probably damaging 1.00
R7327:Mndal UTSW 1 173875619 missense unknown
R7648:Mndal UTSW 1 173857395 missense probably benign 0.01
R8130:Mndal UTSW 1 173871545 nonsense probably null
R8514:Mndal UTSW 1 173860192 missense possibly damaging 0.84
Z1177:Mndal UTSW 1 173874404 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTATCCCTAGCCAAGGTAGAATC -3'
(R):5'- TACAGTGAGCCAGTATTTCCATGTG -3'

Sequencing Primer
(F):5'- CCCTAGCCAAGGTAGAATCTTGTG -3'
(R):5'- GCCAGTATTTCCATGTGAAAGTTTTC -3'
Posted On2017-02-10