Mutagenetix > Incidental Mutation

Incidental Mutation 'R5910:Pou2f3'

460930

Institutional Source

Beutler Lab

Gene Symbol

Pou2f3

Ensembl Gene

ENSMUSG00000032015

Gene Name

POU domain, class 2, transcription factor 3

Synonyms

Otf-11, Epoc-1, Oct11, Skin, Skn-li, Skn-1a, Oct-11a, Skin-1a, Otf11

MMRRC Submission

044107-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5910 (G1)

Quality Score

201

Status

Validated

Chromosome

Chromosomal Location

43123939-43210369 bp(-) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

C to T at 43134474 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000135115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034513] [ENSMUST00000176636]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000034513

SMART Domains

Protein: ENSMUSP00000034513
Gene: ENSMUSG00000032015

Domain	Start	End	E-Value	Type
low complexity region	107	122	N/A	INTRINSIC
low complexity region	150	162	N/A	INTRINSIC
POU	164	238	1.47e-53	SMART
low complexity region	239	256	N/A	INTRINSIC
HOX	262	324	8.39e-20	SMART
low complexity region	337	352	N/A	INTRINSIC
low complexity region	362	378	N/A	INTRINSIC
low complexity region	386	408	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000176636

SMART Domains

Protein: ENSMUSP00000135115
Gene: ENSMUSG00000032015

Domain	Start	End	E-Value	Type
low complexity region	119	134	N/A	INTRINSIC
low complexity region	162	174	N/A	INTRINSIC
POU	176	250	1.47e-53	SMART
low complexity region	251	268	N/A	INTRINSIC
HOX	274	336	8.39e-20	SMART
low complexity region	349	364	N/A	INTRINSIC
low complexity region	374	390	N/A	INTRINSIC
low complexity region	398	420	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213862

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.0%
20x: 90.5%

Validation Efficiency

95% (93/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein is primarily expressed in the epidermis, and plays a critical role in keratinocyte proliferation and differentiation. The encoded protein is also a candidate tumor suppressor protein, and aberrant promoter methylation of this gene may play a role in cervical cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one null mutation exhibit defective keratinocyte differentiation, however the skin and coat appear normal. Mice homozygous for another null mutation display loss of sweet, umami and bitter taste perception and expansion of sour taste receptor cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,668,117	N976D	probably damaging	Het
Adamts1	G	A	16: 85,802,149	R188W	probably benign	Het
Adcy4	A	T	14: 55,779,013	V327D	probably damaging	Het
Alg8	T	C	7: 97,390,286	I408T	possibly damaging	Het
Ankib1	T	C	5: 3,693,217	S933G	probably benign	Het
Ap2a2	A	G	7: 141,598,778	D106G	probably damaging	Het
Arhgap22	A	T	14: 33,366,615	H351L	probably damaging	Het
Arhgef2	A	G	3: 88,635,020	Y310C	probably damaging	Het
Atm	A	T	9: 53,448,080	S2804R	probably damaging	Het
Baz2b	A	G	2: 59,977,426	L163P	possibly damaging	Het
Bcl2l12	C	T	7: 44,996,543		probably null	Het
Cdh23	A	G	10: 60,377,821	V1495A	possibly damaging	Het
Cep78	A	G	19: 15,969,128	S447P	possibly damaging	Het
Cfap43	G	A	19: 47,780,271	T778I	possibly damaging	Het
Cfap54	A	T	10: 93,065,181	N170K	probably damaging	Het
Cmya5	A	T	13: 93,092,643	L1979Q	probably damaging	Het
Col15a1	A	T	4: 47,289,514	E846D	probably damaging	Het
Col5a1	A	G	2: 28,036,888	K308E	possibly damaging	Het
Dcst1	T	A	3: 89,350,424	T680S	possibly damaging	Het
Dsp	T	C	13: 38,192,469	L1410P	possibly damaging	Het
Edem3	T	A	1: 151,770,827		probably null	Het
Eif4e2	T	A	1: 87,220,974	Y64N	probably damaging	Het
Fcgbp	C	T	7: 28,085,503		probably benign	Het
Gm11639	A	T	11: 104,690,934	E34V	probably benign	Het
Gm7275	A	T	16: 48,073,463		noncoding transcript	Het
Grin3b	G	T	10: 79,973,021	V202L	probably benign	Het
Gsdmc4	G	A	15: 63,895,252	S223F	possibly damaging	Het
Hbp1	T	C	12: 31,937,652	H183R	probably benign	Het
Hectd3	A	G	4: 117,002,134	M652V	probably benign	Het
Hist1h2bm	A	G	13: 21,722,300	N68S	probably benign	Het
Hmgxb4	T	C	8: 74,999,565	F13L	probably benign	Het
Hnrnpab	T	C	11: 51,601,454	K271R	probably benign	Het
Ilvbl	A	T	10: 78,577,113	K156N	probably benign	Het
Iqce	A	T	5: 140,702,218		probably benign	Het
Itpr2	C	A	6: 146,329,571	V1194L	probably benign	Het
Kif18b	A	G	11: 102,913,544	F384L	probably benign	Het
Klf14	A	G	6: 30,957,839	Y287H	probably benign	Het
Klhl6	A	G	16: 19,957,094	M238T	probably benign	Het
Lbp	G	A	2: 158,324,557	V344I	probably benign	Het
Lrp12	T	C	15: 39,876,043		probably null	Het
Mapk7	T	A	11: 61,493,621	M1L	probably benign	Het
Muc5b	A	G	7: 141,861,311	T2665A	possibly damaging	Het
Ncln	A	T	10: 81,496,078		probably null	Het
Nfxl1	T	C	5: 72,540,365	R347G	probably benign	Het
Npnt	C	A	3: 132,906,418	C231F	probably damaging	Het
Nrap	T	A	19: 56,342,311	H1070L	probably benign	Het
Nrxn1	G	T	17: 90,704,318	Y294*	probably null	Het
Olfr1261	A	G	2: 89,993,438	D15G	probably benign	Het
Olfr1412	T	C	1: 92,588,707	Y126H	probably damaging	Het
Otog	A	G	7: 46,298,598	H2341R	possibly damaging	Het
Paqr3	T	C	5: 97,096,028		probably null	Het
Pcdhb11	T	C	18: 37,423,743	F709L	probably benign	Het
Phf12	G	A	11: 78,027,398	R812Q	probably damaging	Het
Polr2a	A	T	11: 69,746,870	L216Q	probably damaging	Het
Polrmt	A	G	10: 79,743,497	L140P	probably benign	Het
Prkcd	A	T	14: 30,595,981	N548K	probably benign	Het
Pygb	A	G	2: 150,815,700	D361G	probably benign	Het
Rpl9	A	T	5: 65,388,701		probably benign	Het
Rubcnl	A	T	14: 75,035,472	T211S	probably benign	Het
Rusc1	C	T	3: 89,091,720	G252S	probably benign	Het
Scnn1g	A	G	7: 121,738,095	T60A	probably damaging	Het
Sipa1l2	T	G	8: 125,491,684	T305P	probably benign	Het
Slc18b1	T	A	10: 23,824,667		probably benign	Het
Sp100	G	A	1: 85,681,140		probably null	Het
Tekt5	A	T	16: 10,387,153		probably null	Het
Tlnrd1	T	A	7: 83,884,485		probably benign	Het
Tpcn1	A	G	5: 120,547,397		probably benign	Het
Tpcn2	T	C	7: 145,260,982	I461V	probably benign	Het
Traf3ip1	A	G	1: 91,527,745	K643E	probably damaging	Het
Trim33	T	C	3: 103,344,576	C914R	probably damaging	Het
Trip11	G	A	12: 101,883,479	T1442I	probably damaging	Het
Ttll6	A	G	11: 96,135,589	M107V	possibly damaging	Het
Uap1l1	A	G	2: 25,363,433		probably benign	Het
Ube3b	T	A	5: 114,415,309	I914N	possibly damaging	Het
Usp24	A	G	4: 106,380,468	T1107A	probably damaging	Het
Usp40	A	T	1: 87,968,400	C811*	probably null	Het
Vps11	T	C	9: 44,359,135		probably null	Het
Wdr91	A	T	6: 34,891,487	I433N	possibly damaging	Het
Zfp770	G	C	2: 114,196,232	S452*	probably null	Het

Other mutations in Pou2f3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Pou2f3	APN	9	43128893	missense	probably damaging	1.00
IGL00508:Pou2f3	APN	9	43139963	missense	probably benign	0.01
IGL00975:Pou2f3	APN	9	43137384	missense	probably benign
IGL01577:Pou2f3	APN	9	43146881	nonsense	probably null
IGL01871:Pou2f3	APN	9	43134473	splice site	probably benign
IGL02370:Pou2f3	APN	9	43137348	missense	probably damaging	1.00
IGL02674:Pou2f3	APN	9	43139333	missense	probably damaging	1.00
IGL02746:Pou2f3	APN	9	43146846	missense	probably benign	0.01
IGL02956:Pou2f3	APN	9	43142805	splice site	probably benign
IGL02962:Pou2f3	APN	9	43125089	utr 3 prime	probably benign
IGL03082:Pou2f3	APN	9	43146915	critical splice acceptor site	probably null
R0433:Pou2f3	UTSW	9	43127398	missense	probably benign	0.23
R0622:Pou2f3	UTSW	9	43125119	missense	probably damaging	1.00
R0926:Pou2f3	UTSW	9	43146901	missense	probably damaging	1.00
R1956:Pou2f3	UTSW	9	43145237	missense	probably benign
R4782:Pou2f3	UTSW	9	43139858	missense	probably damaging	0.97
R4877:Pou2f3	UTSW	9	43139323	missense	possibly damaging	0.58
R5070:Pou2f3	UTSW	9	43145281	missense	possibly damaging	0.52
R6280:Pou2f3	UTSW	9	43139339	missense	probably damaging	1.00
R6280:Pou2f3	UTSW	9	43139340	missense	probably damaging	1.00
R6465:Pou2f3	UTSW	9	43139867	missense	probably damaging	1.00
R7084:Pou2f3	UTSW	9	43128893	missense	probably damaging	1.00
R7161:Pou2f3	UTSW	9	43139363	missense	probably damaging	1.00
R8036:Pou2f3	UTSW	9	43146908	missense	probably damaging	1.00
R8406:Pou2f3	UTSW	9	43139858	missense	probably damaging	0.97
R8912:Pou2f3	UTSW	9	43199039	missense	probably benign	0.00
R9224:Pou2f3	UTSW	9	43139399	missense	probably damaging	1.00
R9329:Pou2f3	UTSW	9	43128929	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCCAGTCAAAATTGTGCAC -3'
(R):5'- TTGGATCATCCGACCCTCAC -3'

Sequencing Primer
(F):5'- AAGGACCTTTATCGGCTACG -3'
(R):5'- ACCTCCAATTTCTGAGCCTG -3'

Posted On

2017-02-28